Clone Read LE_HBa0120K01_SP6_87648

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120K01_SP6_87648
Primer
SP6
ID from Seq. Facility
LE_HBa_120_K01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
679 trimmed for vector and quality, 795 raw
Sequence
>LE_HBa0120K01_SP6_87648 (raw untrimmed)
GTTTTTGATAGCCCCAATTTTTCCGATTCGGCGGTTCGATCTATGATTTATCATTCATGGACGTTGATAAGATCCATCCATTTAGCAGCACCTTAGGATG
GCATAGCCTTAAAAGTGAAGGGCGAGGTTCAAACGAGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAATCGACGAAAT
GCTTCGGGGAGTTGAAAATAAGCATAGATCCGGAGATTCCCGAATAGGGCAACCTTTCGAACTGCTGCTGAATCCATGGGCAGGCAAGAGACAACCTGGC
GAACTGAAACATCTTAGTAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGTAGCGGCGAGCGAAATGGGAGCAGCCTAAACCGTGAAAACGGGGTT
GTGGGAGAGCAATACAAGCGTCGTGCTGCTAGGCGAAGCAGCCTGAATGCTGCACCCTAGATGGCGAAAGTCCAGTAGCCGAAAGCATCACTAGCTTACG
CTCTGACCCGAGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCACCTTGCAAGGCTAAATACTCCTGGGTGACCGATAGCGAAGTAGTA
CCGTGAGGGAAGGGTGAAAAGAACCCCCATCGGGGAGTGAAATAGAACATGAAACCGTAAGCTCCCAAGCAGTGGGAGGAGCCAGGGCTCTGACCGCGTG
CCTGTTTGAAGAATGAACCGGCGACTCTTAAGCAGTGGCTTGGTTAAGGGAACCCACCGGAGCCGTAACCAAAGCGAGTCTTCTTAGGGCAATTG
>LE_HBa0120K01_SP6_87648 (trimmed for quality and cloning vector)
TTTTTCCGATTCGGCGGTTCGATCTATGATTTATCATTCATGGACGTTGATAAGATCCATCCATTTAGCAGCACCTTAGGATGGCATAGCCTTAAAAGTG
AAGGGCGAGGTTCAAACGAGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAATCGACGAAATGCTTCGGGGAGTTGAAA
ATAAGCATAGATCCGGAGATTCCCGAATAGGGCAACCTTTCGAACTGCTGCTGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAG
TAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGTAGCGGCGAGCGAAATGGGAGCAGCCTAAACCGTGAAAACGGGGTTGTGGGAGAGCAATACAA
GCGTCGTGCTGCTAGGCGAAGCAGCCTGAATGCTGCACCCTAGATGGCGAAAGTCCAGTAGCCGAAAGCATCACTAGCTTACGCTCTGACCCGAGTAGCA
TGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCACCTTGCAAGGCTAAATACTCCTGGGTGACCGATAGCGAAGTAGTACCGTGAGGGAAGGGTGA
AAAGAACCCCCATCGGGGAGTGAAATAGAACATGAAACCGTAAGCTCCCAAGCAGTGGGAGGAGCCAGGGCTCTGACCG

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.981126
Expected error %
0.133496
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAR91119.1| Score 99 E Value 1e-19 Identity 45.40% Align. Length 290bp (42.71%) Frame 2
chloroplast hypothetical protein [Zea mays]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB67229.1| Score 84 E Value 3e-15 Identity 24.70% Align. Length 161bp (23.71%) Frame 2
hypothetical protein [Oenothera elata subsp. hookeri] emb|CAB67216.1| hypothetical protein [Oenothera elata subsp. hookeri] ref|NP_084760.1| hypothetical protein OeelhCp107 [Oenothera elata subsp. hookeri] ref|NP_084748.1| hypothetical protein OeelhCp093 [Oenothera elata subsp. hookeri]
E. coli K12 Genome (E.coli_K12/Ecoli_genome)NCBI BLAST
gi|16127994|ref|NC_000913.1| Score 78 E Value 1e-14 Identity 87.80% Align. Length 326bp (48.01%) Frame 3
Escherichia coli K12, complete genome
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 121 E Value 7e-29 Identity 98.60% Align. Length 71bp (10.46%) Frame 3
No sequence description found.
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 1330 E Value 0 Identity 99.70% Align. Length 678bp (99.85%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120K01
Clone
Clone name
hba-120k1
LE_HBa0120K01
P120K01
Clone type
BAC
Contamination
none
Estimated length
101,154
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found