Clone Read LE_HBa0120K01_T7_87649

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120K01_T7_87649
Primer
T7
ID from Seq. Facility
LE_HBa_120_K01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 787 raw
Sequence
>LE_HBa0120K01_T7_87649 (raw untrimmed)
GGCTGGGATCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCATAAAAGCTAGACTAAGCAATAGCGTACCTCGTATTTTGCCCTCTGCCT
CAGGCTGTCTCGCGATACCCTCTACAGCTTGACCCGCAGCAGTCCCTTGACCAACTCCAGGTCCAATAGAAGCAAGCCCTACGGCCAATCCAGCAGCAAT
AACGGAAGCGGCAGAAATCAGTGGATTCATGATAAGTTCCTCGTACCAAAAAAAGAAATGGTTAATGATACAATCAACCAATGAATTATGACTTAATTAT
TCCCTCACTAGGACTCATCCAGTCGAAGTAACTAAGAACTTCGGATTGAAGTAATAAGATTCTTGAATCATCAAAACAACTTCGATATATCTTTTTTACT
TTTTAGCCACAGAGTCTTTGTGAACCCATACGACTTTCATTCTTCCATTTCTTGTTCTTGGTTCGAACTGTTAGTTGAATTATTTCTTGATTTCATCCGT
TTAGTCATTCAATTCACAGTCACAAGGGGCCGGAAGGACTTCTAGTCTATTAGAATCCCCTAGAAAAATATATCTTTAGTAGTTCATTTCATATATAACT
AGCACTAGGCAATATCTAATATCACATATACATGTCTTTCTTCCATAACGTAAACCAAGCATTCATCTTAGATTTAATCCTATTCGAGAATCAAGCGTCG
AAACATCTAGAAGGGTTCGCTTATAGTTTATTCAAGTAAAGAAACCTCCCCGCCCCTTTCCAAAATACTAAAAAAAACTTTTGAAAA
>LE_HBa0120K01_T7_87649 (trimmed for quality and cloning vector)
AGCTTCCATAAAAGCTAGACTAAGCAATAGCGTACCTCGTATTTTGCCCTCTGCCTCAGGCTGTCTCGCGATACCCTCTACAGCTTGACCCGCAGCAGTC
CCTTGACCAACTCCAGGTCCAATAGAAGCAAGCCCTACGGCCAATCCAGCAGCAATAACGGAAGCGGCAGAAATCAGTGGATTCATGATAAGTTCCTCGT
ACCAAAAAAAGAAATGGTTAATGATACAATCAACCAATGAATTATGACTTAATTATTCCCTCACTAGGACTCATCCAGTCGAAGTAACTAAGAACTTCGG
ATTGAAGTAATAAGATTCTTGAATCATCAAAACAACTTCGATATATCTTTTTTACTTTTTAGCCACAGAGTCTTTGTGAACCCATACGACTTTCATTCTT
CCATTTCTTGTTCTTGGTTCGAACTGTTAGTTGAATTATTTCTTGATTTCATCCGTTTAGTCATTCAATTCACAGTCACAAGGGGCCGGAAGGACTTCTA
GTCTATTAGAATCCCCTAGAAAAATATATCTTTAGTAGTTCATTTCATATATAACTAGCACTAGGCAATATCTAATATCACATATACATGTCTTTCTTCC
ATAACGTAAACCAAGCATTCATCTTAGATTTAATCCTATTCGAGAATCAAGCGTCGAAACATCTAGAAGGGTTCGCTTATAGTTTATTCAAGTAAAGAAA
CCTCCCCGCCC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963593
Expected error %
0.724694
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP36991.1| Score 81 E Value 2e-14 Identity 25.30% Align. Length 185bp (26.02%) Frame 2
ATPase subunit III [Cucumis sativus] emb|CAA28066.1| atpH [Marchantia polymorpha] emb|CAB67158.1| ATP synthase subunit III [Oenothera elata subsp. hookeri] dbj|BAC85068.1| ATP synthase III subunit [Physcomitrella patens subsp. patens] ref|NP_084693.1| ATP synthase CF0 C chain [Oenothera elata subsp. hookeri] ref|NP_904218.1| ATP synthase CF0 C chain [Physcomitrella patens subsp. patens] sp|P62480|ATPH_OENHO ATP synthase C chain (Lipid-binding protein) (Subunit III) sp|P62481|ATPH_MARPO ATP synthase C chain (Lipid-binding protein) (Subunit III) ref|NP_039280.1| ATP synthase CF0 C chain [Marchantia polymorpha]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP29379.2| Score 81 E Value 2e-14 Identity 25.30% Align. Length 185bp (26.02%) Frame 2
ATP synthase CF0 C chain [Adiantum capillus-veneris] emb|CAA77343.1| ATPase III subunit [Nicotiana tabacum] gb|AAX58147.1| ATPase subunit III [Lactuca sativa] emb|CAF28580.1| ATPase III subunit [Nymphaea alba] emb|CAD45095.2| ATPase III subunit [Amborella trichopoda] emb|CAD28708.1| ATPase III subunit [Calycanthus floridus var. glaucus] dbj|BAD93462.1| ATP synthase CF0 C chain [Silene latifolia] ref|NP_848047.2| ATP synthase CF0 C chain [Adiantum capillus-veneris] dbj|BAC55422.1| ATPase III subunit [Anthoceros formosae] ref|NP_862741.1| ATP synthase CF0 C chain [Calycanthus floridus var. glaucus] ref|NP_054483.1| ATP synthase CF0 C chain [Nicotiana tabacum] ref|YP_086953.1| atpAse subunit III [Panax ginseng] dbj|BAB84203.1| ATP synthase subunit CF0 III [Psilotum nudum] ref|NP_569616.1| ATP synthase CF0 C chain [Psilotum nudum] ref|YP_053142.1| ATPase III subunit [Nymphaea alba] ref|NP_777395.1| ATP synthase CF0 C chain [Anthoceros formosae] ref|NP_904086.1| ATPase III subunit [Amborella trichopoda] gb|AAT98496.1| atpAse subunit III [Panax ginseng] sp|P61172|ATPH_ANTFO ATP synthase C chain (Lipid-binding protein) (Subunit III) sp|P06286|ATPH_TOBAC ATP synthase C chain (Lipid-binding protein) (Subunit III) dbj|BAC55331.1| ATPase III subunit [Anthoceros formosae] gb|AAA84678.1| ATPase subunit III prf||1211235G ATPase III prf||1102209A ATPase III,H translocating
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 577 E Value 1e-166 Identity 95.40% Align. Length 705bp (99.16%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120K01
Clone
Clone name
hba-120k1
LE_HBa0120K01
P120K01
Clone type
BAC
Contamination
none
Estimated length
101,154
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found