Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0120L04_T7_87703

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120L04_T7_87703
Primer
T7
ID from Seq. Facility
LE_HBa_120_L04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
590 trimmed for vector and quality, 809 raw
Sequence
>LE_HBa0120L04_T7_87703 (raw untrimmed)
GCTGGGTCCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGAAGTTCTTTTAGTATTAAGACTTTTATGTTTCTTTCCTTTTTCACTTG
GATATTAAACGTTCTATGAGCTATATATGGTCTTATTTTATTGATGTATGGGCTTGGTCCGTTTTTATACACTCTTATTAAGTGGTTATGAGATGAGATG
ACTAATTGAGACTATGTTATATTCTATATATTTGTCTTCAATAAAAGTTAAAGACTATGTAATCTTCCTATACGAAGAGTCTATCTATACTCGATATATA
TATGTGTGTGTGTGTCTATATGTCGAGGTCAATGTGAACCTTAATGTAGAAATAGTAAAAAAAAATTCCATTATTTTGACTTATAAATGTAATGATATAA
ACGAAGAGGCTAGTCTTAGTCCTCAACGAAAACGATGACGTCGGTTACGTCTAGGGGTTTTTTTCCTTGATATTACAAAAATGAAACACATGTAAATGTA
TTTACAAGGATGTCTTGAGGAGTCTACTTAGTTTAGGTAGGGGTAAGATACTCTACCTAGACATTGCGCAAGTTGACTCTATTGGGAAGTCCTAGGAGAT
TTTTCTCATGTAACATGTATATTAAATGTATAATTTTTCTGATCTATGATGACGCTCTTATTCAATGTTTACTATTGGCATTGAACATAATTCTTTTTTA
ATAATTTTTTTTTTATTTATACTAACTTATGATAGTAAAATTTATTGGACCTTATCATTTTTTATTTTCCGTCTCTTTTTGATTTTTTTTTTTGATATGT
GAGTATTTG
>LE_HBa0120L04_T7_87703 (trimmed for quality and cloning vector)
AGCTTATGAAGTTCTTTTAGTATTAAGACTTTTATGTTTCTTTCCTTTTTCACTTGGATATTAAACGTTCTATGAGCTATATATGGTCTTATTTTATTGA
TGTATGGGCTTGGTCCGTTTTTATACACTCTTATTAAGTGGTTATGAGATGAGATGACTAATTGAGACTATGTTATATTCTATATATTTGTCTTCAATAA
AAGTTAAAGACTATGTAATCTTCCTATACGAAGAGTCTATCTATACTCGATATATATATGTGTGTGTGTGTCTATATGTCGAGGTCAATGTGAACCTTAA
TGTAGAAATAGTAAAAAAAAATTCCATTATTTTGACTTATAAATGTAATGATATAAACGAAGAGGCTAGTCTTAGTCCTCAACGAAAACGATGACGTCGG
TTACGTCTAGGGGTTTTTTTCCTTGATATTACAAAAATGAAACACATGTAAATGTATTTACAAGGATGTCTTGAGGAGTCTACTTAGTTTAGGTAGGGGT
AAGATACTCTACCTAGACATTGCGCAAGTTGACTCTATTGGGAAGTCCTAGGAGATTTTTCTCATGTAACATGTATATTAAATGTATAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.928211
Expected error %
0.705863
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120L04
Clone
Clone name
hba-120l4
LE_HBa0120L04
P120L04
Clone type
BAC
Contamination
none
Estimated length
130,329
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found