Clone Read LE_HBa0120P08_SP6_87902

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0120P08_SP6_87902
Primer
SP6
ID from Seq. Facility
LE_HBa_120_P08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
642 trimmed for vector and quality, 804 raw
Sequence
>LE_HBa0120P08_SP6_87902 (raw untrimmed)
TTACCGGTATAACTTATATCATCATATAGAGGCCCTGCGACATATAAGCCATCGGTCCCTGTGGTAGTTTGATGTGCTAAATCGCCTTGCTTAAGTGGAG
CACTTTGGCTGTCTCCTGTAGCAATTATTTTGACAACAACATCATTGAGAGGGGGAGAAACTGATCCTTCTATATACATCCCAAGTCGACCAGCAAAAGG
AGGAATTGAAGATTGGCAGCCATCTTCCATCACAGCAACCTAGAGAAAGCAAAGAAAGACTTCAAAACTAAGAGTAGATACACAAAAACTACTTTGATTA
AAACTTTCAATTCCACATACATGCTGCTGTGTGGGATAAAATAATATTTTTTTCCCGCCATCATCCCTGAAACATGAAACAACAATTAGAAATGCATGAA
AAGCTGAGGAATTATAACAAAGTAGCATTTAAAAATACATCTATTCTTGATTGTGTGCAAGGCAATGTCTCAAAGCATTTGAGCATGTCAGGAAACACAT
TTACTCTAATCTTTGAATTACAAACATTCTGCCATCTAATACCATGTGCATCACACTACAAAGTGCATGAAACAAGCTCGAAAAATACAGCTAAAAAAGT
GAGCATATATTTTGGAAAGTCAGAATCAGGCAGATGAAGGTACAGAGGAGGATGTTGAGAAGATACATGTTGCAGAGATGAGGATGTTGAGATGGATGTG
TGGGCACACTAGGACTCACAAGATCGAGTAGGAGGTTATCCGGGAGAAGGAGAAATGGCCCCCTTTTTGTTGAACAATATTGAGGAACCAAGTTACTTTG
GTTT
>LE_HBa0120P08_SP6_87902 (trimmed for quality and cloning vector)
TATCATCATATAGAGGCCCTGCGACATATAAGCCATCGGTCCCTGTGGTAGTTTGATGTGCTAAATCGCCTTGCTTAAGTGGAGCACTTTGGCTGTCTCC
TGTAGCAATTATTTTGACAACAACATCATTGAGAGGGGGAGAAACTGATCCTTCTATATACATCCCAAGTCGACCAGCAAAAGGAGGAATTGAAGATTGG
CAGCCATCTTCCATCACAGCAACCTAGAGAAAGCAAAGAAAGACTTCAAAACTAAGAGTAGATACACAAAAACTACTTTGATTAAAACTTTCAATTCCAC
ATACATGCTGCTGTGTGGGATAAAATAATATTTTTTTCCCGCCATCATCCCTGAAACATGAAACAACAATTAGAAATGCATGAAAAGCTGAGGAATTATA
ACAAAGTAGCATTTAAAAATACATCTATTCTTGATTGTGTGCAAGGCAATGTCTCAAAGCATTTGAGCATGTCAGGAAACACATTTACTCTAATCTTTGA
ATTACAAACATTCTGCCATCTAATACCATGTGCATCACACTACAAAGTGCATGAAACAAGCTCGAAAAATACAGCTAAAAAAGTGAGCATATATTTTGGA
AAGTCAGAATCAGGCAGATGAAGGTACAGAGGAGGATGTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959602
Expected error %
0.04797
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g62360.1 Score 91 E Value 7e-19 Identity 14.60% Align. Length 335bp (52.18%) Frame 3
68416.m07005 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD94972.1| Score 91 E Value 3e-17 Identity 14.60% Align. Length 335bp (52.18%) Frame 3
putative protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB82950.1| Score 91 E Value 3e-17 Identity 14.60% Align. Length 335bp (52.18%) Frame 3
putative protein [Arabidopsis thaliana] ref|NP_191795.1| expressed protein [Arabidopsis thaliana] pir||T48028 hypothetical protein T12C14.60 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0120P08
Clone
Clone name
hba-120p8
LE_HBa0120P08
P120P08
Clone type
BAC
Contamination
none
Estimated length
107,780
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found