Clone Read LE_HBa0139D18_SP6_88114

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139D18_SP6_88114
Primer
SP6
ID from Seq. Facility
LE_HBa_139_D18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
446 trimmed for vector and quality, 930 raw
Genbank Accession
Sequence
>LE_HBa0139D18_SP6_88114 (raw untrimmed)
GCAATGGAGTGGATGATTGTCTGCTAGGTGCTTGTGCTTGTCGTTCTCTTACACCATTTTTAGTATTTGGACATGTCTGTTGACTACTTATTTGATACTT
CAGAAGGAATTTATAG
AATTCATATGATGTGTATTCCCCACCATTGGCAGTTCTGAGGCGAAGAAATTTCTTGCCAACTTCTGTTTCAACAACCTTTATA
AATTCTTTGAATTTTAAAAATGTACTAATACTTTTTCTTCAGAAAATAACTCCATACATACCTGGAAAAATCATCAATGAATGTTAACATATATATCATC
CCACAAACAGATAGTTGCTTGAGAGGTCCAAATACATCTGAGTGAATTACTTCCTGATGTTCCTTGGCCTTATATTTCAAATACTCGTACGAAAATTGAT
GTGCTTTACCATATTGGCAATCCACACATAAAACATCTTTCCTTAGTGGGAGTTTTGGACTACCCTTCAACGTTGACTTTTCCATCATGACACTTAATTA
TAAAGAAACTAACGTGTGTCAACCGCACATGCCATAAGTCTGCAATTTCATTCTTTTTTGTCATGTCTATAGATGTGGTTTCTGTCCATATAACATAAAT
GGAATTCAATCTTCGTCCCTTATTTACCGGCTTTTTTATGACTCAATATCTTCATATACACTTACATGTTGCGGACCAAAGAGAATATAATGATCCGTAG
ATGTTAGCCTGTATTAATGAAAGAAGATTTTTCTTCATTCCTTGGACCTTATAAACTTTTCGAAGCAACATCATATCAACATTACTGTTTGGAGAGTCGG
GAACCGTTCTGTTGGAAAATATGAAAATTGGTGCAGCTTGATTTTCTCACCCACTACTTAACCCTTCATATTATTGATTAATTACTCCTCCCTCCCTGCC
GTCGTATCGTTTATCTACTCTACCGACAGC
>LE_HBa0139D18_SP6_88114 (trimmed for quality and cloning vector)
AATTCATATGATGTGTATTCCCCACCATTGGCAGTTCTGAGGCGAAGAAATTTCTTGCCAACTTCTGTTTCAACAACCTTTATAAATTCTTTGAATTTTA
AAAATGTACTAATACTTTTTCTTCAGAAAATAACTCCATACATACCTGGAAAAATCATCAATGAATGTTAACATATATATCATCCCACAAACAGATAGTT
GCTTGAGAGGTCCAAATACATCTGAGTGAATTACTTCCTGATGTTCCTTGGCCTTATATTTCAAATACTCGTACGAAAATTGATGTGCTTTACCATATTG
GCAATCCACACATAAAACATCTTTCCTTAGTGGGAGTTTTGGACTACCCTTCAACGTTGACTTTTCCATCATGACACTTAATTATAAAGAAACTAACGTG
TGTCAACCGCACATGCCATAAGTCTGCAATTTCATTCTTTTTTGTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950395
Expected error %
2.06688
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX92861.1| Score 62 E Value 5e-13 Identity 34.90% Align. Length 418bp (93.72%) Frame 1
retrotransposon protein, putative, Ty1-copia sub-class [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB75932.1| Score 62 E Value 6e-13 Identity 37.20% Align. Length 378bp (84.75%) Frame 1
putative protein [Arabidopsis thaliana] pir||T47841 hypothetical protein T2O9.150 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139D18
Clone
Clone name
hba-139d18
LE_HBa0139D18
P139D18
Clone type
BAC
Contamination
none
Estimated length
93,073
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found