Clone Read LE_HBa0139D18_T7_88115

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139D18_T7_88115
Primer
T7
ID from Seq. Facility
LE_HBa_139_D18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
728 trimmed for vector and quality, 816 raw
Genbank Accession
Sequence
>LE_HBa0139D18_T7_88115 (raw untrimmed)
CGGTCCCCGGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGATCACCATTTATTTGGTAACTAGGGAAACATGAGGGTCTTAGGATAGAG
AGTACAAATGTTCAAGGATTCAATATGGTGACCAAACAAATATGGTTTCTTCTTAGGGCTAATTAAGATGATATTAATAGGAGGGGAATTTATGATAGTG
AGGAAAGGCCTATATTCATCATTCAAGGAAAATTCGATCTATAACTTTTCCTTGAATTTTTTTTGGGACAAGTTTAAGACAACATGCACATACAAGAATG
AATCAATCTCTTCCGCACAAGACAATAAAAAACAACATATGAATATCCCACTTGTCGATCATAAAGCAAACTCAATGATGTAGGAATCATGAAATTAGAT
TGTTTTTCAATTCACTTTAAAAAAAAAATTCTTTTTCCAAAATCTTTTTTGGCAGTTTCTCTAGCAAGAGGTGCAACATCAGACTTAATTTCAACTAAAA
CATGACATTATTCCATAAGGAAATCGCGTATGATCTATCATTGGGAACACCAACTCAGTTCGACAAAAAAAGACTCAAGAATAAAAAAAGCTAAAAATTA
TCTTGCTCCTTGGGAAAGAACCATTGTATAAAGAAAACTCTTAGATTTTACTAAACTACTTGTACTATTCACCTTACCCCAAAATTAACAAGCAATTGGC
TCATAGCATGAGTAATTTAGTTGTACCTATTTGTTTGAAGTTTGTGCTAAACTGGCGAATTGCCCATTCATATGGCTTACCACCGGCGGTCCATTGAACT
ACGGAAATAGAGGGTA
>LE_HBa0139D18_T7_88115 (trimmed for quality and cloning vector)
AGCTTAGATCACCATTTATTTGGTAACTAGGGAAACATGAGGGTCTTAGGATAGAGAGTACAAATGTTCAAGGATTCAATATGGTGACCAAACAAATATG
GTTTCTTCTTAGGGCTAATTAAGATGATATTAATAGGAGGGGAATTTATGATAGTGAGGAAAGGCCTATATTCATCATTCAAGGAAAATTCGATCTATAA
CTTTTCCTTGAATTTTTTTTGGGACAAGTTTAAGACAACATGCACATACAAGAATGAATCAATCTCTTCCGCACAAGACAATAAAAAACAACATATGAAT
ATCCCACTTGTCGATCATAAAGCAAACTCAATGATGTAGGAATCATGAAATTAGATTGTTTTTCAATTCACTTTAAAAAAAAAATTCTTTTTCCAAAATC
TTTTTTGGCAGTTTCTCTAGCAAGAGGTGCAACATCAGACTTAATTTCAACTAAAACATGACATTATTCCATAAGGAAATCGCGTATGATCTATCATTGG
GAACACCAACTCAGTTCGACAAAAAAAGACTCAAGAATAAAAAAAGCTAAAAATTATCTTGCTCCTTGGGAAAGAACCATTGTATAAAGAAAACTCTTAG
ATTTTACTAAACTACTTGTACTATTCACCTTACCCCAAAATTAACAAGCAATTGGCTCATAGCATGAGTAATTTAGTTGTACCTATTTGTTTGAAGTTTG
TGCTAAACTGGCGAATTGCCCATTCATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.930695
Expected error %
0.510715
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139D18
Clone
Clone name
hba-139d18
LE_HBa0139D18
P139D18
Clone type
BAC
Contamination
none
Estimated length
93,073
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found