Clone Read LE_HBa0139J14_SP6_88394

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139J14_SP6_88394
Primer
SP6
ID from Seq. Facility
LE_HBa_139_J14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 881 raw
Genbank Accession
Sequence
>LE_HBa0139J14_SP6_88394 (raw untrimmed)
ATTTCCCCCTATGCTTTCCTCCCAACTTGCGAGTAGACCGGCTTTTCAAGAACTCTTTTATATGCCTTAAAATAGTTAAAAGGGACTATTCAGTTGTCCT
AGAAAAAGAAGTTAAAGGAAGATGGCATAGCAAAGTTAGCAACTTACCTTTTGACAGTATTTCTTTAAACGGTCCTTGAGCTTTACTTGTTGTTCTGCTT
TAGGCAAATCAAGAAAAGACTTTGATCGTTGACCATCTCCTACTTCAACAAGTTCAGATTCGAGTTGTCTCTTTATGTGGTAATAATCACTGATGTTTGG
TATAAACAAAATATCAAGTTTCAGTAGCAATCTATCTGAAGTTTCCAATTTTTCACTAAATGACTAGAAAATATACCTCCTTTTTGCCATGTATATTTCA
CCACGCCAAACCCACTCAAGCTTCCGGAGACACTTTTTGCCAGGACGATTAAAATCGCATGCAGTGCATATCTCATCTGATACTATTGATGGTGGCTGAT
GGAATCAAGTTTAAAGTTAGATTCAAAAGGCTACCAAATATAAAATGCTACATCCACAATAAAGAGATAATGCACCCAACATGAAGCACCTCCTCAATAA
GACAGCAGAAGTAAAAATCAGTATTTGTCAGCTGTTCAGCACATCATGTTTTAAAAGCAATTGGGTGTCAGCCATAAAAAGATCCACATAAAGCCCATTG
CAAGCATCAAAAAGTAACTGCCCAATTGTTTCTCTTAATTTTCTTAGGCTGCTTCTTGAAATGACACAATACAAAAAATATTGATGATACTCCTAAACTC
CAATTATTCTTTTTAGGCTGTTACCACCCCAAAATAAAATTAAAATAATTATTAAAGGTCATGCCTAAAAGGCGGCATCAA
>LE_HBa0139J14_SP6_88394 (trimmed for quality and cloning vector)
GACCGGCTTTTCAAGAACTCTTTTATATGCCTTAAAATAGTTAAAAGGGACTATTCAGTTGTCCTAGAAAAAGAAGTTAAAGGAAGATGGCATAGCAAAG
TTAGCAACTTACCTTTTGACAGTATTTCTTTAAACGGTCCTTGAGCTTTACTTGTTGTTCTGCTTTAGGCAAATCAAGAAAAGACTTTGATCGTTGACCA
TCTCCTACTTCAACAAGTTCAGATTCGAGTTGTCTCTTTATGTGGTAATAATCACTGATGTTTGGTATAAACAAAATATCAAGTTTCAGTAGCAATCTAT
CTGAAGTTTCCAATTTTTCACTAAATGACTAGAAAATATACCTCCTTTTTGCCATGTATATTTCACCACGCCAAACCCACTCAAGCTTCCGGAGACACTT
TTTGCCAGGACGATTAAAATCGCATGCAGTGCATATCTCATCTGATACTATTGATGGTGGCTGATGGAATCAAGTTTAAAGTTAGATTCAAAAGGCTACC
AAATATAAAATGCTACATCCACAATAAAGAGATAATGCACCCAACATGAAGCACCTCCTCAATAAGACAGCAGAAGTAAAAATCAGTATTTGTCAGCTGT
TCAGCACATCATGTTTTAAAAGCAATTGGGTGTCAGCCATAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961249
Expected error %
0.232482
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g08260.1 Score 129 E Value 1e-31 Identity 56.90% Align. Length 459bp (71.38%) Frame 2
68414.m00911 DNA-directed DNA polymerase epsilon catalytic subunit, putative similar to SP|Q07864 DNA polymerase epsilon, catalytic subunit A (EC 2.7.7.7) (DNA polymerase II subunit A) {Homo sapiens}; contains Pfam profiles: PF03175 DNA polymerase type B, organellar and viral, PF00136 DNA polymerase family B, PF03104 DNA polymerase family B, exonuclease domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g27120.1 Score 122 E Value 8e-29 Identity 54.70% Align. Length 462bp (71.85%) Frame 2
68415.m03259 DNA-directed DNA polymerase epsilon catalytic subunit, putative similar to SP|Q07864 DNA polymerase epsilon, catalytic subunit A (EC 2.7.7.7) (DNA polymerase II subunit A) {Homo sapiens}; contains Pfam profiles: PF03175 DNA polymerase type B, organellar and viral, PF00136 DNA polymerase family B, PF03104 DNA polymerase family B, exonuclease domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_172303.1| Score 129 E Value 5e-30 Identity 56.90% Align. Length 459bp (71.38%) Frame 2
DNA-directed DNA polymerase epsilon catalytic subunit, putative [Arabidopsis thaliana] gb|AAF18240.1| T23G18.11 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_465943.1| Score 127 E Value 5e-29 Identity 55.60% Align. Length 462bp (71.85%) Frame 2
putative DNA polymerase epsilon catalytic subunit protein isoform b [Oryza sativa (japonica cultivar-group)] dbj|BAD23092.1| putative DNA polymerase epsilon catalytic subunit protein isoform b [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139J14
Clone
Clone name
hba-139j14
LE_HBa0139J14
C11HBa0139J14
P139J14
Clone type
BAC
Contamination
none
Estimated length
90,079
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found