Clone Read LE_HBa0139J14_T7_88395

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139J14_T7_88395
Primer
T7
ID from Seq. Facility
LE_HBa_139_J14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
787 trimmed for vector and quality, 837 raw
Genbank Accession
Sequence
>LE_HBa0139J14_T7_88395 (raw untrimmed)
TAAATTCGGTACCCGGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATAGTATTACAAAGAAAAAGTAGAGTTATTATAACAAAGATAGGGAA
TAGGGTAAAATAAGATTTTTAGATGATAAAAGTAGGATGAAAAGAAATAAGCTAACGACACGACACCACCCAATGGGTTGTTCCTGGCATTATTCATCGT
TACATAAAAACGAATTTCACAGTACAAATACAATAAAATTTATTAAAAAACAATTATAACCGGCTTTCGATTAATACAACGATATACAATACAATAGGTA
ACAAGAGGTGGAATCAGAATTCGAACCTTATGTGTTCTTGATTTTAATATTTTTAAGTTACTAGGTTCTAAATTAGATACTACTTTGTACATATTCAATG
ATTTAAAAAAAAAAAATTTGAACCATAGTTACTGGATTCAGCCGAACCAGTAGCTTACACTTAAGCTCTGTCCCTGATAACAACCATTCAAACAAAACGT
AAACTTCTACTCTGGAAACACAAGCATCTAAAATTATACAAATTGTTGGATAAGGACAACGTCCTGCCTATGACAAGGCCCACAAGGGCTCTCGGTGGCT
CGAATTGGAGTCATGATCAAACATAGAGCTTGTGTGGTGTGTGGTGCAGTTAGTTTCCCCTTTGCTATATCTAATATGACTATTGGCATAATGGTAAGCG
TTTGATCTTTGACATACATGAACAATTCCACTGCAAAAACAGGGAAACGAAGTACCTTTTTGCTCTTGGGGAGTAACTTTATTGGTAAGAACATCCAATC
CTTGATAACCTAACCAAGAAACAAAAGGGTTAGCAGT
>LE_HBa0139J14_T7_88395 (trimmed for quality and cloning vector)
AGCTTATAGTATTACAAAGAAAAAGTAGAGTTATTATAACAAAGATAGGGAATAGGGTAAAATAAGATTTTTAGATGATAAAAGTAGGATGAAAAGAAAT
AAGCTAACGACACGACACCACCCAATGGGTTGTTCCTGGCATTATTCATCGTTACATAAAAACGAATTTCACAGTACAAATACAATAAAATTTATTAAAA
AACAATTATAACCGGCTTTCGATTAATACAACGATATACAATACAATAGGTAACAAGAGGTGGAATCAGAATTCGAACCTTATGTGTTCTTGATTTTAAT
ATTTTTAAGTTACTAGGTTCTAAATTAGATACTACTTTGTACATATTCAATGATTTAAAAAAAAAAAATTTGAACCATAGTTACTGGATTCAGCCGAACC
AGTAGCTTACACTTAAGCTCTGTCCCTGATAACAACCATTCAAACAAAACGTAAACTTCTACTCTGGAAACACAAGCATCTAAAATTATACAAATTGTTG
GATAAGGACAACGTCCTGCCTATGACAAGGCCCACAAGGGCTCTCGGTGGCTCGAATTGGAGTCATGATCAAACATAGAGCTTGTGTGGTGTGTGGTGCA
GTTAGTTTCCCCTTTGCTATATCTAATATGACTATTGGCATAATGGTAAGCGTTTGATCTTTGACATACATGAACAATTCCACTGCAAAAACAGGGAAAC
GAAGTACCTTTTTGCTCTTGGGGAGTAACTTTATTGGTAAGAACATCCAATCCTTGATAACCTAACCAAGAAACAAAAGGGTTAGCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952544
Expected error %
0.288003
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139J14
Clone
Clone name
hba-139j14
LE_HBa0139J14
C11HBa0139J14
P139J14
Clone type
BAC
Contamination
none
Estimated length
90,079
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found