Clone Read LE_HBa0143D14_SP6_88874

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143D14_SP6_88874
Primer
SP6
ID from Seq. Facility
LE_HBa_143_D14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
707 trimmed for vector and quality, 920 raw
Genbank Accession
Sequence
>LE_HBa0143D14_SP6_88874 (raw untrimmed)
GCCAAAGCTTTGTTTATCCAGGAGATTTTCTTTAACTTTTCAGCAATCTCGGCATAAGGACACTCCCCATCACCACTAAACACTATAGTATCTAATACCG
CTTTATTATTATCATCCTGTCCCCGATAGAAGTATTCCTTTAGTGACTCATTATATTTGTGGTGATTGGGGATGCTTCTAACGAATGAAGTGAATCTCTC
CCAAGAATTTCTAATTCACTCTCGTTGTAGTGCCACAAAGTAGTACTCTGTCTTTGTGATTTAGTTTCTTTGAAATCGGGTCATAACGTGCTAAGAAAAT
GTGCCTTTGTTGGTTCCAAGTGAAAATTGAGTTATTAGGGAGCTCAGTGAAGCAAATAGCAACCTCTCACGTCAGTGTGAAAGGAAATACTTTTAGTCCT
ATTACATCCAAATCCAAATCTGGCCTCCCTACACATCTTTTACACACTTCCCTTACCTTAGCTATATGGGCATGTAAGTCCTCAGAAGGTAGCACTGAAA
ACAAACCTTTAGCATTGATTTTCATAAGACTACTAGTTAACACAAAGATGTGACCTTGTGGTAGAGGGGGCAAGACAAGTGGGTCATTAGAGTCTGCAAT
GTTATCATAACCTCTGTAGTATTCTTGAGGGCGTGGAGCAGGATTTTGTCCCCTTTGTTTATTTTCACCAAGATCATCGGGTAATAAGTGACAATGAACA
TCAACATGAGTTGGGATGTTCTGGTTTGGGATCATCATTGTTAATCCCAAGTTTTGAATCTTATTTGTAGTGTACCTCTAATTCGCGGTCGAAGGGAAAC
AAGGTTCTCCTTCCTCTCCATGTTTTTGCCAACCAAATAAGTATTTCTGTAAGATAAAAAACATTAAAAAAAGAAATTAGAAAAATGTGTCTTACTTTGT
TAATATCTTAAATTAATTTA
>LE_HBa0143D14_SP6_88874 (trimmed for quality and cloning vector)
ATTTTCTTTAACTTTTCAGCAATCTCGGCATAAGGACACTCCCCATCACCACTAAACACTATAGTATCTAATACCGCTTTATTATTATCATCCTGTCCCC
GATAGAAGTATTCCTTTAGTGACTCATTATATTTGTGGTGATTGGGGATGCTTCTAACGAATGAAGTGAATCTCTCCCAAGAATTTCTAATTCACTCTCG
TTGTAGTGCCACAAAGTAGTACTCTGTCTTTGTGATTTAGTTTCTTTGAAATCGGGTCATAACGTGCTAAGAAAATGTGCCTTTGTTGGTTCCAAGTGAA
AATTGAGTTATTAGGGAGCTCAGTGAAGCAAATAGCAACCTCTCACGTCAGTGTGAAAGGAAATACTTTTAGTCCTATTACATCCAAATCCAAATCTGGC
CTCCCTACACATCTTTTACACACTTCCCTTACCTTAGCTATATGGGCATGTAAGTCCTCAGAAGGTAGCACTGAAAACAAACCTTTAGCATTGATTTTCA
TAAGACTACTAGTTAACACAAAGATGTGACCTTGTGGTAGAGGGGGCAAGACAAGTGGGTCATTAGAGTCTGCAATGTTATCATAACCTCTGTAGTATTC
TTGAGGGCGTGGAGCAGGATTTTGTCCCCTTTGTTTATTTTCACCAAGATCATCGGGTAATAAGTGACAATGAACATCAACATGAGTTGGGATGTTCTGG
TTTGGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966094
Expected error %
0.314922
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 85 E Value 2e-27 Identity 39.20% Align. Length 453bp (64.07%) Frame 1
putative reverse transcriptase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAB18645.1| Score 65 E Value 2e-11 Identity 30.50% Align. Length 507bp (71.71%) Frame 1
unknown [Hordeum vulgare] pir||T06196 hypothetical protein - barley
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143D14
Clone
Clone name
hba-143d14
LE_HBa0143D14
P143D14
Clone type
BAC
Contamination
none
Estimated length
107,169
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found