Clone Read LE_HBa0143E06_SP6_88906

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143E06_SP6_88906
Primer
SP6
ID from Seq. Facility
LE_HBa_143_E06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
673 trimmed for vector and quality, 918 raw
Genbank Accession
Sequence
>LE_HBa0143E06_SP6_88906 (raw untrimmed)
GATAAACCTTTCATCAATATCGAAAATGCTCTTCTTGTCTCCGCACATGTGGTTGCTACACCCGGTGTCCTACTATTCAGATTTTGTTGAGTTTCTTCAC
TTTCATAACACACCTTTAAGAGAGAAACTTCTTCTTCCTTCTCTGCAAAGTTAGATACTTCTGCACTCTGTCTATTTAAATTTGTTCGACATTCTAATTG
GTAATGACCATACCTATGGCAGCGATAGAACTCAACATTTGTTTTGTCTACTGACTTTGGTTTCTGAGTTGTTGAGTCATGTCCTCCACATCCCCTTCCT
CTCTGTTGAAACTGATCATCATTCTGCTAATGGTACTGTTAATTACCTCGACTGTAGCTTCCTCTCCCCTACTCCGACCTCAACCTCCACTTGTTTTAGA
AGGATTATCGGTGGTTGCTTTCAGTGCGTGCTTTTCTTTGTCCTGCTGGATGATTTTCTGCTCATGAACTAACAAAGAATTTTTCAATTCATCAATGGAG
AGTTCATCAATATCCTTCGATTCTTCGATAGAGAAGACAACAAAAATTAAATTTCTGTGTCATTGATCGAAGGATTTTCTCAACAATGGTGACATCCTGC
ATTTGCTCTCCATGGATTCTCATCTTGCTTGCAATTGCCATAGTTCTTGAAAAGAAATCTGTAACTGTATCTCCTGATTTCATACGCAAAGTCTCAAATT
CAGTTCCGAATCCTTGGAGTTGTACCCTTTTTGCCTTCACATTGCCTTGACACTTCTTCTCCATGGAGTCCCAAATTTTCTGGAAGGTTCCTTGGCAAGA
AAAGCCTCCAAATGAACCATCAATAACTTCAAACAAATTAATTTTTAGCCTTAAGATCTTTAATTTTAAGACTTTAAATTCCGTTTTCTGAACTTTGTAA
ACCTTGGTTGCGGGTCAG
>LE_HBa0143E06_SP6_88906 (trimmed for quality and cloning vector)
TCTTGTCTCCGCACATGTGGTTGCTACACCCGGTGTCCTACTATTCAGATTTTGTTGAGTTTCTTCACTTTCATAACACACCTTTAAGAGAGAAACTTCT
TCTTCCTTCTCTGCAAAGTTAGATACTTCTGCACTCTGTCTATTTAAATTTGTTCGACATTCTAATTGGTAATGACCATACCTATGGCAGCGATAGAACT
CAACATTTGTTTTGTCTACTGACTTTGGTTTCTGAGTTGTTGAGTCATGTCCTCCACATCCCCTTCCTCTCTGTTGAAACTGATCATCATTCTGCTAATG
GTACTGTTAATTACCTCGACTGTAGCTTCCTCTCCCCTACTCCGACCTCAACCTCCACTTGTTTTAGAAGGATTATCGGTGGTTGCTTTCAGTGCGTGCT
TTTCTTTGTCCTGCTGGATGATTTTCTGCTCATGAACTAACAAAGAATTTTTCAATTCATCAATGGAGAGTTCATCAATATCCTTCGATTCTTCGATAGA
GAAGACAACAAAAATTAAATTTCTGTGTCATTGATCGAAGGATTTTCTCAACAATGGTGACATCCTGCATTTGCTCTCCATGGATTCTCATCTTGCTTGC
AATTGCCATAGTTCTTGAAAAGAAATCTGTAACTGTATCTCCTGATTTCATACGCAAAGTCTCAAATTCAGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954996
Expected error %
0.337501
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG51247.1| Score 67 E Value 2e-12 Identity 28.40% Align. Length 664bp (98.66%) Frame 3
copia-type polyprotein, putative; 28768-32772 [Arabidopsis thaliana] pir||E86451 probable copia-type polyprotein, 28768-32772 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB11200.1| Score 67 E Value 2e-12 Identity 28.40% Align. Length 664bp (98.66%) Frame 3
copia-type polyprotein [Arabidopsis thaliana] emb|CAC37622.1| polyprotein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143E06
Clone
Clone name
hba-143e6
LE_HBa0143E06
P143E06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found