Clone Read LE_HBa0143E06_T7_88907

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143E06_T7_88907
Primer
T7
ID from Seq. Facility
LE_HBa_143_E06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
126 trimmed for vector and quality, 977 raw
Sequence
>LE_HBa0143E06_T7_88907 (raw untrimmed)
CTGTGGTCCCGGGGGATCTTCTAGAGTCGACCTGCAGGCATGCTAGCTTCTAACATATTCACTATGTAATAGAGTATTGTGAAAAGTTTTTTGCTCAAAA
TTATATAACCCTTTTCCATTTCACAGGGCTTTTGATTTATCGAATTTTATACNNATATGTGTTGTTTGTTTGTTTGTTTTTTGGATATTTTTTTTTTTCT
TGGGAACCTTTTTTAAAGAATCGATTTTAGTTAACTTTTATTATGTGGTTTTTCCCCCAAATTTTTTGAGGTGGGAAACTAATTTCCCAAGGGATTTCCT
TTTTTTTTTTAAATTTCCGGGGGTTTTTCTTTTTTTAAAAACTTTTAATTTTAAAATTTATAAATTTATTTTTTTAACTTCGGGGGTTTTTTTTTGGGGG
TTTTTATAAAAAAGGGGAAATATTTTTCTCTCTAAAATTAAATTAATTTTTAATATTTTCGGCCCAC
GTTTTTTTTTTTTTTTTCTTTCGTTTTATTTTT
TTTTTTTTTTCTTCAAATCGAGCTCCGCTTTTATATATTTTTCTTTTTTTTCCCTCTTTGTAAAAAAAGAAAAGATAAGAAAAAAAAAAAAATAACCCTC
TCCCTCTATATATAATAAATAAGNNTTNATAACATTAATTTCCTTTTTATTTTTTCTTTTTTATATTTTCTTTTATATATTTCTATCTTATTTTTTTTTT
GTGTTTAAATTTATTTTCTTTTTCACACTCTCTTGTCTTTTTGTGTTTATGTCGTTATGTAATATATGTAATTTTATTTTGATATTTACTTTTTTTTTAT
TTTTTTTTCTTATTTTCTTCTTTTTATATCTTATTAATATGTCATTCCCTTTCCTTTTTTTTCTTTCTTTTTTTTTTGTTTTATTTTATTTTATATGTAT
TTATTTCTTTTTACTCTAATCTGTATTTAATTCTAATTATTTAATTTTTTTATTTTTTGATATTTTAATTTATTTCA
>LE_HBa0143E06_T7_88907 (trimmed for quality and cloning vector)
GTTTTTTTTTTTTTTTTCTTTCGTTTTATTTTTTTTTTTTTTTCTTCAAATCGAGCTCCGCTTTTATATATTTTTCTTTTTTTTCCCTCTTTGTAAAAAA
AGAAAAGATAAGAAAAAAAAAAAAAT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.701681
Expected error %
8.26425
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143E06
Clone
Clone name
hba-143e6
LE_HBa0143E06
P143E06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found