Clone Read LE_HBa0143H24_SP6_89086

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143H24_SP6_89086
Primer
SP6
ID from Seq. Facility
LE_HBa_143_H24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
624 trimmed for vector and quality, 869 raw
Genbank Accession
Sequence
>LE_HBa0143H24_SP6_89086 (raw untrimmed)
ACCCTAACGTTCAGAAACTCAAGACCTTGGTTGACTACTGCACCAATTCTTACCTTGCCAGTGGAAGGTAAAATCTTTTTTATTTATTGTGATGCATCTT
ATTCTTGTTTGGGTGCAGTGCTGAAGCAGGAGAGGAATGTAATTGCTTATGCTTCGAGGCAATTAAAAGTGCATGAACGTAACTATCTGACCCATGATTT
GGAGTTGGTTGCAGTTGTATGTGCATTAAAGCAATGGAGACATTATCTATATGGGGTCAAGTGTGAAGTTTACATAGATCATGGTAGTCTACAATATGTC
TTTACTCAGAAGGATTTAAATTTGAGGCAGAGAAGGTGGATGGAATTATTGAAAGATTTTGATATTACTATTTTATATCACCCTGGAAAAGCTAATGTTG
TGGCAGATGCCTTATGTAGAAAAGCAGGGAGCATGGGTAGTTTAGCCCACTTACAGGTTTCTAGAAGCCCCTTGGCTAGAGAGGTTCAGACTCTGGCTAA
TGACTTTATTAGGCTGGAAGTACTAGAGAAAAGAAGGATTTTTGGCCTCTATGGAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGGAAAACAGTTTGC
TGATGAGAAGCTGAGCCGAATTCGAGATATGGTATTGCGAGGAGAGGCTAAAGAGGAAATTATTGACGAGGAAGGCGTCTTGAGAATTAAGGGAAGAGTA
TGTGTGCCTTGTGTTGATGATTTGACTCACACTATTCTTACAGAGGGTCATAGTTTCAGGTATTCCCATAATTCTTGGTTGCAACCAAAATGTATTCGTG
TTTTAAAAAACTTTTTTGGGTGAAGCAAAAATAAACCTGAACATTGTTGATTTTGTTGCTTAATGCCCA
>LE_HBa0143H24_SP6_89086 (trimmed for quality and cloning vector)
TGACTACTGCACCAATTCTTACCTTGCCAGTGGAAGGTAAAATCTTTTTTATTTATTGTGATGCATCTTATTCTTGTTTGGGTGCAGTGCTGAAGCAGGA
GAGGAATGTAATTGCTTATGCTTCGAGGCAATTAAAAGTGCATGAACGTAACTATCTGACCCATGATTTGGAGTTGGTTGCAGTTGTATGTGCATTAAAG
CAATGGAGACATTATCTATATGGGGTCAAGTGTGAAGTTTACATAGATCATGGTAGTCTACAATATGTCTTTACTCAGAAGGATTTAAATTTGAGGCAGA
GAAGGTGGATGGAATTATTGAAAGATTTTGATATTACTATTTTATATCACCCTGGAAAAGCTAATGTTGTGGCAGATGCCTTATGTAGAAAAGCAGGGAG
CATGGGTAGTTTAGCCCACTTACAGGTTTCTAGAAGCCCCTTGGCTAGAGAGGTTCAGACTCTGGCTAATGACTTTATTAGGCTGGAAGTACTAGAGAAA
AGAAGGATTTTTGGCCTCTATGGAGGCAAGATCTTCCTTTCTTGACAAGATTAAGGGAAAACAGTTTGCTGATGAGAAGCTGAGCCGAATTCGAGATATG
GTATTGCGAGGAGAGGCTAAAGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954678
Expected error %
0.166826
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 246 E Value 5e-69 Identity 69.00% Align. Length 612bp (98.08%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 241 E Value 2e-66 Identity 70.10% Align. Length 603bp (96.63%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143H24
Clone
Clone name
hba-143h24
LE_HBa0143H24
P143H24
Clone type
BAC
Contamination
none
Estimated length
80,926
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found