Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

Clone Read LE_HBa0143J24_SP6_89182

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143J24_SP6_89182
Primer
SP6
ID from Seq. Facility
LE_HBa_143_J24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
636 trimmed for vector and quality, 859 raw
Genbank Accession
Sequence
>LE_HBa0143J24_SP6_89182 (raw untrimmed)
GCCTATAGGTGTTTTTGTTTTATCAAGGCCCACCATGTGGTTGTTGGATGAGTGCTAAGTTGGATTGTTTGCCACTCATGATTTACATTTCAAATGGAAC
ATAAAAATGTAGGTTAAAGGTGGACTGTTGTATCATTACATTCTTATTCTTGTATTGTAAACAGTTTTCAGAGAACTTTACCATTATGCTGTTTCACTAT
GACGGCCGAACAACTGAATGGGATGACCTTGAGTGGTCAGCACGGGCTATCCATGTCAGTACACCGAAACAGACTAAATGGTACCTTTCTTGTAAATTCT
TTCTATCCTCAATTCTTCAACATATTTGATGGATATGTAAGTGCAGTGTTTATTCATTTTGTTGAAAGGTGGTATGCAAAACGTTTTCTACATCCTGACA
TTGTAGCACCATATGACTATATATTCATCTGGGATGAAGACTTGGGGCTTGAAAATTTTAACGCGGAGGAGTAAGTGATTATAATTAGAGCCATGTGAAT
CAACAAATATATTGAATTATGTGGAGTCTTAAGGCTTAATGCAAATGCAGATATATAAAGTTGGTGACGAAACATGGTTTGGATATTTCACAGCCTGGTT
TAGAACCAAAACAGTGGGTTGACATGGCAGATGACAAAAGGGAGAAATGACACTGTAGTTCACAAGTAGGGAACACAGTACTTTAATTTACCTACGGCTG
CTTTGATAAAGCATATCATGCAAAAAGTTTGATCTATAATACAATTTTTCGCTTCTGCTAACAGGAAAACAGAGAAAAAGGACATGCGGGTGCTGCGATC
CACATTTGCCACCTATTGCAGCATACTAAATGTTTGAATTTATCTTTACTAATTATTTT
>LE_HBa0143J24_SP6_89182 (trimmed for quality and cloning vector)
TGGTTGTTGGATGAGTGCTAAGTTGGATTGTTTGCCACTCATGATTTACATTTCAAATGGAACATAAAAATGTAGGTTAAAGGTGGACTGTTGTATCATT
ACATTCTTATTCTTGTATTGTAAACAGTTTTCAGAGAACTTTACCATTATGCTGTTTCACTATGACGGCCGAACAACTGAATGGGATGACCTTGAGTGGT
CAGCACGGGCTATCCATGTCAGTACACCGAAACAGACTAAATGGTACCTTTCTTGTAAATTCTTTCTATCCTCAATTCTTCAACATATTTGATGGATATG
TAAGTGCAGTGTTTATTCATTTTGTTGAAAGGTGGTATGCAAAACGTTTTCTACATCCTGACATTGTAGCACCATATGACTATATATTCATCTGGGATGA
AGACTTGGGGCTTGAAAATTTTAACGCGGAGGAGTAAGTGATTATAATTAGAGCCATGTGAATCAACAAATATATTGAATTATGTGGAGTCTTAAGGCTT
AATGCAAATGCAGATATATAAAGTTGGTGACGAAACATGGTTTGGATATTTCACAGCCTGGTTTAGAACCAAAACAGTGGGTTGACATGGCAGATGACAA
AAGGGAGAAATGACACTGTAGTTCACAAGTAGGGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953337
Expected error %
0.17795
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g13000.1 Score 86 E Value 2e-19 Identity 53.00% Align. Length 533bp (83.81%) Frame 3
68414.m01509 expressed protein contains Pfam profile PF05212: Protein of unknown function (DUF707)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g67850.2 Score 84 E Value 5e-17 Identity 48.50% Align. Length 555bp (87.26%) Frame 3
68414.m07746 expressed protein contains Pfam profile PF05212: Protein of unknown function (DUF707)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_465088.1| Score 83 E Value 7e-33 Identity 48.50% Align. Length 507bp (79.72%) Frame 3
unknown protein [Oryza sativa (japonica cultivar-group)] ref|XP_507466.1| PREDICTED OJ1654_A02.17 gene product [Oryza sativa (japonica cultivar-group)] ref|XP_506776.1| PREDICTED OJ1654_A02.17 gene product [Oryza sativa (japonica cultivar-group)] dbj|BAD21688.1| unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO33772.1| Score 83 E Value 2e-19 Identity 43.40% Align. Length 504bp (79.25%) Frame 3
unknown [Oryza sativa (indica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143J24
Clone
Clone name
hba-143j24
LE_HBa0143J24
C02HBa0143J24
P143J24
Clone type
BAC
Contamination
none
Estimated length
108,019
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found