Clone Read LE_HBa0143J24_T7_89183

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0143J24_T7_89183
Primer
T7
ID from Seq. Facility
LE_HBa_143_J24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
683 trimmed for vector and quality, 728 raw
Genbank Accession
Sequence
>LE_HBa0143J24_T7_89183 (raw untrimmed)
CTGGGTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACGCACAACAGTAAAATGAGAACGCTTCCCTGGTTTTGTCCATTCGGAGGTT
AACATGGGCGCACCCTATCTGCAAAATCAACATATGCTCTTTTTTAGTAAAACTTCAAGGAAATTCCTGTCAAGCAGTTTCCACAAGCAAAATTAAATGT
ATCCTTATTTTTTTTTAGTTTTTCTCATTAGCAGCTCTAACACATTTATTTCATTGATACCGAGCAACAACATACCTATTGTAATCCCGCAAAGTAGGGT
CTGGGGAGGGTAAGGTATACGCAGTAATGCTGACCCACCCCTACCTAGGAGGAGAAGCTGTTTACCATAGACCCACTCAAGAGAAAAAACAGTTCAATGT
AGTATAGAGAAAGATATAATGGAAATGAAAAAATTCATGGGAAGATACTAAAGACAATCTTACAATCAACCTGAACAAAACCCATAACAAAGTAAAAAAA
TAATAGAAGTACAAAAAGAAACAAATAATAACCAAACTCAAAGGACAAGAAACTATAAGGGTAATACAACAACTAATAGGACGGCTAATAGTACAAAGAT
ATAAGCAAGATAGCACCTAACTATTTGACTAACCTTTTACCCTAACCCACGACCACCATAACACTCTAAGGTCATGTCCTCAGAAAGTTGAAGGTTTCAT
CATAACTAGTCTAATCAACTCTCCTCAA
>LE_HBa0143J24_T7_89183 (trimmed for quality and cloning vector)
AGCTTACGCACAACAGTAAAATGAGAACGCTTCCCTGGTTTTGTCCATTCGGAGGTTAACATGGGCGCACCCTATCTGCAAAATCAACATATGCTCTTTT
TTAGTAAAACTTCAAGGAAATTCCTGTCAAGCAGTTTCCACAAGCAAAATTAAATGTATCCTTATTTTTTTTTAGTTTTTCTCATTAGCAGCTCTAACAC
ATTTATTTCATTGATACCGAGCAACAACATACCTATTGTAATCCCGCAAAGTAGGGTCTGGGGAGGGTAAGGTATACGCAGTAATGCTGACCCACCCCTA
CCTAGGAGGAGAAGCTGTTTACCATAGACCCACTCAAGAGAAAAAACAGTTCAATGTAGTATAGAGAAAGATATAATGGAAATGAAAAAATTCATGGGAA
GATACTAAAGACAATCTTACAATCAACCTGAACAAAACCCATAACAAAGTAAAAAAATAATAGAAGTACAAAAAGAAACAAATAATAACCAAACTCAAAG
GACAAGAAACTATAAGGGTAATACAACAACTAATAGGACGGCTAATAGTACAAAGATATAAGCAAGATAGCACCTAACTATTTGACTAACCTTTTACCCT
AACCCACGACCACCATAACACTCTAAGGTCATGTCCTCAGAAAGTTGAAGGTTTCATCATAACTAGTCTAATCAACTCTCCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950603
Expected error %
0.405262
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0143J24
Clone
Clone name
hba-143j24
LE_HBa0143J24
C02HBa0143J24
P143J24
Clone type
BAC
Contamination
none
Estimated length
108,019
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found