Clone Read LE_HBa0149A16_SP6_89502

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149A16_SP6_89502
Primer
SP6
ID from Seq. Facility
LE_HBa_149_A16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
221 trimmed for vector and quality, 895 raw
Sequence
>LE_HBa0149A16_SP6_89502 (raw untrimmed)
ATACGGGTGACGTGAGGCACTAACTGACTTCAAGGCTTTGAGTTGAATATTTAGATTCTTTCATATATCATCTAGCACGAATAATCTTAGTCCTTCAACT
CAGCCATCTTCTTGTCTTGTACTCGTTTGTCCTTATGATCGCCAATCCCATAATTTTCTGTTGACTCTGGGCCGCTCCATTTTACCACCTCCCTAATCAT
TCTTTTTTCCCTCATGGTAGAAATGACAGATGTCAACGGTTCAAATCCCATTCTCTACATACAAGAATGTTATCTATCGGAAATAATTATGTAGCACACA
GAGGTAGGGGTAAGGTCCGCATACATCCTATCTTCCCCATGCTCCACTTGTGTGATTATACTGGGTCTGTTGTTGTTGTTGGTGGTGGCGCGACTTCTTT
TTTCCGGTGCTCTATACTCGACTAAAAAATATTCTTATGCACAAGTGTATCTAATACGGACCGTCATAAATATAAATTGAGATATTTTGCCCCACCTATC
TTTAAAAACCCTGCTTAGAATATAAGAATAAATGGTGTAATCCGGCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCGCCCCCCCC
CCCCCCCCCCCCACANNNNNNANNAANANANAANNNNNAAAAAAAAAAAAAAAAAATAGAAAAGATAAGGAAGAGGAAAGAAGAGTTATAGTTTTATTTA
AAATTTTGTATAATAAGTATAAATATTATTTTTTGTAAATTATTGTAGGTTTTTTAAATACTCTTATTTTATAGTCACAAATCATCTGAGTAGAGTTTTT
GTTCTTTTTTTAATTATACGCTGTTTTTTTTTATATTTTTTATAATTTTTTTTTATAGTTTTTATACCTTCTCGTATCCTTTTCATTTTCTTTTT
>LE_HBa0149A16_SP6_89502 (trimmed for quality and cloning vector)
CCTTCAACTCAGCCATCTTCTTGTCTTGTACTCGTTTGTCCTTATGATCGCCAATCCCATAATTTTCTGTTGACTCTGGGCCGCTCCATTTTACCACCTC
CCTAATCATTCTTTTTTCCCTCATGGTAGAAATGACAGATGTCAACGGTTCAAATCCCATTCTCTACATACAAGAATGTTATCTATCGGAAATAATTATG
TAGCACACAGAGGTAGGGGTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96124
Expected error %
1.19554
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149A16
Clone
Clone name
hba-149a16
LE_HBa0149A16
P149A16
Clone type
BAC
Contamination
none
Estimated length
65,099
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found