Clone Read LE_HBa0149A16_T7_89503

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149A16_T7_89503
Primer
T7
ID from Seq. Facility
LE_HBa_149_A16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
768 trimmed for vector and quality, 812 raw
Sequence
>LE_HBa0149A16_T7_89503 (raw untrimmed)
GCTGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTAGCTAATGAATCACGTACCAAAGTCTCCTCACAAACTAATAATGGTAG
GATTACATGCCTGAACAATAGAAATTGTGGAATTTCTGGATGATCAAATTCTCTGGGCGGATCAGGGCAAGTGAATTCTGCCATTTCGAGCTCCTCAACT
CATACAAATGTAACGAATCCCCACACGATAAGGGCACGCCTAAATGCAGTTACAAGCTTGTCAAATACAAATAAAACAACTTTTGATGGATCAGAAAATC
AGAATTCCCCCATTTTAAGCTTGTTAGCTCACACAAATGCAATAACTATTCCTCTAGTGGACCCTACAATATTCCCAAAGGAAGCAAAAAAAGCCCACAA
GCATGGGGCACGTCAGACCCTAATTATTATTACAAGCTTACCAAATACAAACGAAGGGGTTAATAGTGGAGAATCAAAGCTCAATTCTTCTCCCATTTCA
AGCTTGTCAACTACACATAGAGTATCTCTTCGCTTTTTTCGCGATCCAAATACAGGATATGTTTCAACAATTATCAACTAATACAAATGAAACAACTCCT
TGAAGACTAGAAAATCCCCCCCCCCCCCAACCCAACCCAACACACACACGGCAACCAAATTTGTCAACCAGTACAATTTGAAGTAACTTCTAATAATTAA
TGGCTAATTTAGCCCACAAAGTAAGTTCTTACTACATTTGTGTTGTATTAATACTATCTAGTATCTATGCCTTGTGTTTTTTGTTAACTCTACATTATTC
CACTTACTTTTG
>LE_HBa0149A16_T7_89503 (trimmed for quality and cloning vector)
AGCTTGTTAGCTAATGAATCACGTACCAAAGTCTCCTCACAAACTAATAATGGTAGGATTACATGCCTGAACAATAGAAATTGTGGAATTTCTGGATGAT
CAAATTCTCTGGGCGGATCAGGGCAAGTGAATTCTGCCATTTCGAGCTCCTCAACTCATACAAATGTAACGAATCCCCACACGATAAGGGCACGCCTAAA
TGCAGTTACAAGCTTGTCAAATACAAATAAAACAACTTTTGATGGATCAGAAAATCAGAATTCCCCCATTTTAAGCTTGTTAGCTCACACAAATGCAATA
ACTATTCCTCTAGTGGACCCTACAATATTCCCAAAGGAAGCAAAAAAAGCCCACAAGCATGGGGCACGTCAGACCCTAATTATTATTACAAGCTTACCAA
ATACAAACGAAGGGGTTAATAGTGGAGAATCAAAGCTCAATTCTTCTCCCATTTCAAGCTTGTCAACTACACATAGAGTATCTCTTCGCTTTTTTCGCGA
TCCAAATACAGGATATGTTTCAACAATTATCAACTAATACAAATGAAACAACTCCTTGAAGACTAGAAAATCCCCCCCCCCCCCAACCCAACCCAACACA
CACACGGCAACCAAATTTGTCAACCAGTACAATTTGAAGTAACTTCTAATAATTAATGGCTAATTTAGCCCACAAAGTAAGTTCTTACTACATTTGTGTT
GTATTAATACTATCTAGTATCTATGCCTTGTGTTTTTTGTTAACTCTACATTATTCCACTTACTTTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961989
Expected error %
1.99533
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149A16
Clone
Clone name
hba-149a16
LE_HBa0149A16
P149A16
Clone type
BAC
Contamination
none
Estimated length
65,099
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found