Clone Read LE_HBa0149B02_SP6_89522

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149B02_SP6_89522
Primer
SP6
ID from Seq. Facility
LE_HBa_149_B02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 712 raw
Sequence
>LE_HBa0149B02_SP6_89522 (raw untrimmed)
AGCCTTTATTTTCTTATGATTGATTGTCCTTATTTTTGGGCATGATGGAGAACACTTTAAGATGAACTGCCCTTTGGGAAGTGAAGCAAATGCATGTTTA
ACAGTATAATGTCTTTCTATTTCCCATGGGACAGGTTTCCATCATGCAGATTGCTTCAGATAACAAAGTTTATATACTTGATCTCATTAAGTTAAATGGA
GATGCTCCGGATGTACTGGATGACTGCTTAACCCGCATATTGCATTCTCCAAGAGTACTGAAGCTTGGTAAGAGAGATTATTGTCTTGTTGGGAGATAAA
TTCTTTTAATCTGTGGGCATTTTCCTGTTATAAGTGCATTACATCTTTTCTGCTCCAAGAAAGAAAACTAGTTGATTTTCATGGCTTCTTTACAATCTTT
GCACTACTTATATCAAGCAGTATGTGTCCATTAAGGGGGATTGCTGATTTAACTAGATATTTGTATGGAACACATTCCTGCTTTTCTTTGGTATACCAGT
ATATTTTCTATCTGTATACTTTATTTGCGGACAAAATTCTACAGTCATAATTTGGTGGTTTTCAGGTTACAACTTCCAGTGTGATGTGAAGCAGCTTGCT
ATATCTTATGGGCAGTTACAATGCTTCAAGCACTATGACATGCTACTCGATATCCAGAATGTGTTCAAAGAACCAAGAGGTGGTCTCTCTGGTCCTGACA
AAGGTATTTCGT
>LE_HBa0149B02_SP6_89522 (trimmed for quality and cloning vector)
ATTGATTGTCCTTATTTTTGGGCATGATGGAGAACACTTTAAGATGAACTGCCCTTTGGGAAGTGAAGCAAATGCATGTTTAACAGTATAATGTCTTTCT
ATTTCCCATGGGACAGGTTTCCATCATGCAGATTGCTTCAGATAACAAAGTTTATATACTTGATCTCATTAAGTTAAATGGAGATGCTCCGGATGTACTG
GATGACTGCTTAACCCGCATATTGCATTCTCCAAGAGTACTGAAGCTTGGTAAGAGAGATTATTGTCTTGTTGGGAGATAAATTCTTTTAATCTGTGGGC
ATTTTCCTGTTATAAGTGCATTACATCTTTTCTGCTCCAAGAAAGAAAACTAGTTGATTTTCATGGCTTCTTTACAATCTTTGCACTACTTATATCAAGC
AGTATGTGTCCATTAAGGGGGATTGCTGATTTAACTAGATATTTGTATGGAACACATTCCTGCTTTTCTTTGGTATACCAGTATATTTTCTATCTGTATA
CTTTATTTGCGGACAAAATTCTACAGTCATAATTTGGTGGTTTTCAGGTTACAACTTCCAGTGTGATGTGAAGCAGCTTGCTATATCTTATGGGCAGTTA
CAATGCTTCAAGCACTATGACATGCTACTCGATATCCAGAATGTGTTCAAAGAACCAAGAGGTGGTCTCTCTGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947973
Expected error %
0.196406
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g56310.1 Score 81 E Value 5e-16 Identity 26.50% Align. Length 131bp (19.41%) Frame 2
68414.m06473 3'-5' exonuclease domain-containing protein contains Pfam profile PF01612: 3'-5' exonuclease
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_176027.1| Score 81 E Value 2e-14 Identity 26.50% Align. Length 131bp (19.41%) Frame 2
3'-5' exonuclease domain-containing protein [Arabidopsis thaliana] gb|AAG50917.1| 3'-5' exonuclease, putative [Arabidopsis thaliana] pir||H96604 probable 3'-5' exonuclease [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149B02
Clone
Clone name
hba-149b2
LE_HBa0149B02
P149B02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found