Clone Read LE_HBa0149B02_T7_89523

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149B02_T7_89523
Primer
T7
ID from Seq. Facility
LE_HBa_149_B02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
665 trimmed for vector and quality, 709 raw
Sequence
>LE_HBa0149B02_T7_89523 (raw untrimmed)
GCCCGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCACATATTTTTCACCAGAATGGATGCTTACCTTTCATTCTGACAAGAGGC
AGTAATGCCTGTGGGAATATGAGTTATCCTGACAGCACTCTCAGTTGTGTTAACAGACTGACCACCAGCTCCCCCTGATCGATAACGCTCAATTCGAAGA
TCAGATTCATTGATTTGAACATGTGTAGATCCATCTCCCAAAATTGGAATTACAGCAACTGCAACAAAGGAAGTATGCCTTCTCTTCGCGCTATCAAATG
GCGAGATGCGTACCAGACGATGCACTCCTACCTCTGATTTGGCATATCCAAAAGCATTTTCGCCATCAACTTTGATTGTTGCACGCTGATAACAGGGGGG
AGCAGAAACCAGCAGAGCAATAAGACAATAGCTAACTAGTGCCATGATTGAAAATTAAGAAGAAAGGGGAAAACTTCCTAATTTTAGGTCAAATATAACC
AATGACAAGATTCACAACCCATACTTTAAAAACATATTAATTACATATATGTTTAACAATTCTGTTATGCTTCAAGGCTAAACCAAGTTCTCCCAACAGA
ATGTTATAAAATTAATGCTTGTTTAAATAGCTAAGAGTTTTTGCCATTCACAAATTTCAATTTTCCATACTACTTAATAGCTAGAGAATTTTTCAAGTGA
AAGAAGAAA
>LE_HBa0149B02_T7_89523 (trimmed for quality and cloning vector)
AGCTTTCACATATTTTTCACCAGAATGGATGCTTACCTTTCATTCTGACAAGAGGCAGTAATGCCTGTGGGAATATGAGTTATCCTGACAGCACTCTCAG
TTGTGTTAACAGACTGACCACCAGCTCCCCCTGATCGATAACGCTCAATTCGAAGATCAGATTCATTGATTTGAACATGTGTAGATCCATCTCCCAAAAT
TGGAATTACAGCAACTGCAACAAAGGAAGTATGCCTTCTCTTCGCGCTATCAAATGGCGAGATGCGTACCAGACGATGCACTCCTACCTCTGATTTGGCA
TATCCAAAAGCATTTTCGCCATCAACTTTGATTGTTGCACGCTGATAACAGGGGGGAGCAGAAACCAGCAGAGCAATAAGACAATAGCTAACTAGTGCCA
TGATTGAAAATTAAGAAGAAAGGGGAAAACTTCCTAATTTTAGGTCAAATATAACCAATGACAAGATTCACAACCCATACTTTAAAAACATATTAATTAC
ATATATGTTTAACAATTCTGTTATGCTTCAAGGCTAAACCAAGTTCTCCCAACAGAATGTTATAAAATTAATGCTTGTTTAAATAGCTAAGAGTTTTTGC
CATTCACAAATTTCAATTTTCCATACTACTTAATAGCTAGAGAATTTTTCAAGTGAAAGAAGAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964403
Expected error %
0.11327
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g56350.1 Score 178 E Value 2e-45 Identity 28.20% Align. Length 308bp (46.32%) Frame 1
68414.m06479 peptide chain release factor, putative similar to SP|P28353 Peptide chain release factor 2 (RF-2). {Salmonella typhi}; contains Pfam profiles PF00472: Peptidyl-tRNA hydrolase domain, PF03462: PCRF domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g36170.2 Score 106 E Value 1e-23 Identity 16.80% Align. Length 302bp (45.41%) Frame 1
68418.m04359 peptide chain release factor, putative similar to SP|P28367 Peptide chain release factor 2 (RF-2) {Bacillus subtilis}; contains Pfam profiles PF00472: Peptidyl-tRNA hydrolase domain, PF03462: PCRF domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG50902.1| Score 178 E Value 9e-44 Identity 28.20% Align. Length 308bp (46.32%) Frame 1
peptide chain release factor 2, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_176032.2| Score 178 E Value 9e-44 Identity 28.20% Align. Length 308bp (46.32%) Frame 1
peptide chain release factor, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149B02
Clone
Clone name
hba-149b2
LE_HBa0149B02
P149B02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found