Clone Read LE_HBa0149C03_SP6_89572

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149C03_SP6_89572
Primer
SP6
ID from Seq. Facility
LE_HBa_149_C03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
408 trimmed for vector and quality, 450 raw
Sequence
>LE_HBa0149C03_SP6_89572 (raw untrimmed)
CTCCTTTGGGGGAATTGCTTGCTTGCTCCGAATCTTCGTTGGAGGTAGGTTATGGTTTTATGCTATTCCTCATTAGACTCTTAATAGCCAATGATATGTG
TTGGGTAGTATTATAAAACCTTCTATATGCTTAATTGTGTGCTTACATGATGTGATTATATAACTGTGATGAATAAGCATGATGAGGCTATTGAATCTCT
AATCCTAATTTTACCTTGTTAATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACTAAAGTAATGAGATTAATGATGTCTTGGTATAAGAGAAGGCT
TGATGAACTAAGTTAATGAGATTGATGATGCCTTGGTATAAAAGAAGGATTGATGAATTAACAGAATGAGATTAGTGGAGCGGGTGTCACGAACCGAAAC
GTAGTATTAGGGGATCGGGTGTCATTAATCAACACCTATTATTAGGGGAT
>LE_HBa0149C03_SP6_89572 (trimmed for quality and cloning vector)
GCTTGCTTGCTCCGAATCTTCGTTGGAGGTAGGTTATGGTTTTATGCTATTCCTCATTAGACTCTTAATAGCCAATGATATGTGTTGGGTAGTATTATAA
AACCTTCTATATGCTTAATTGTGTGCTTACATGATGTGATTATATAACTGTGATGAATAAGCATGATGAGGCTATTGAATCTCTAATCCTAATTTTACCT
TGTTAATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACTAAAGTAATGAGATTAATGATGTCTTGGTATAAGAGAAGGCTTGATGAACTAAGTTAA
TGAGATTGATGATGCCTTGGTATAAAAGAAGGATTGATGAATTAACAGAATGAGATTAGTGGAGCGGGTGTCACGAACCGAAACGTAGTATTAGGGGATC
GGGTGTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946052
Expected error %
0.333602
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149C03
Clone
Clone name
hba-149c3
LE_HBa0149C03
P149C03
Clone type
BAC
Contamination
none
Estimated length
135,987
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found