Clone Read LE_HBa0149C03_T7_89573

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149C03_T7_89573
Primer
T7
ID from Seq. Facility
LE_HBa_149_C03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
478 trimmed for vector and quality, 850 raw
Sequence
>LE_HBa0149C03_T7_89573 (raw untrimmed)
CTCGGTCCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACATTACAAACCAACAAAATCCTATCGTGATCCTAAAAGTCTAATATGGTG
AACTTAAGCAGTGAAAATAAGGTCGAGCCTATGGAGACAAGTACCAACTAGGTATGAATTTTTTTTGAGCGTGACTGTTGAAAAATAATTCTGATACTCA
AAGTTAAAATCACTGTGCCAAAAAGGATGATATCTTTTGAAGTGAGGGCACTAGTTGCAATATCGGAAAGTTGGTACATTAGCAAGAGACAAAAGAGTAC
AGTTGTTGGTGAATTATGAGTCTGTGTCATGGTTTCATCCAAATGAGTAAGTCTATCAATCTAAGAGGATAACATGCACTAAAGCAACGAGAAAGTTGGG
ATTGATAGCCATGTGATTGCGAAAGCTTAAAAAAATACATGTGTACAAAGTGTTGTGTTGAGTCATAGTGCGTCCCTTGAGGACAAACAATGAATTTAAG
TTGAGGGTATTGATGTATCCTGGGATCACGGTACTTTTAATGCCTTATTCTTAAATATTTCGGTTTCCACAACTTCTTTTTATTAATCTTATTTATGCCT
TATATCTTTTTTCTAGTATCAATTGCGCTAATTCCCTCAACTACTACTTATGATATTTTTGCATTGATTATCTGCGCCAACCCATTCTATTACAGACCAT
CTATTTCTTCATTCCATTTGAGCTAATATTTAATTTCTTTTTATATTCACTGTTATTTTTCTTTCTACTTTTTACCCCTTTTTCTTTTTTCTCTCTTCTC
TTGCCCTCCATCCTCTCTACTATTCCTTTCCTTCGCTCATTCCCTTACTC
>LE_HBa0149C03_T7_89573 (trimmed for quality and cloning vector)
AGCTTACATTACAAACCAACAAAATCCTATCGTGATCCTAAAAGTCTAATATGGTGAACTTAAGCAGTGAAAATAAGGTCGAGCCTATGGAGACAAGTAC
CAACTAGGTATGAATTTTTTTTGAGCGTGACTGTTGAAAAATAATTCTGATACTCAAAGTTAAAATCACTGTGCCAAAAAGGATGATATCTTTTGAAGTG
AGGGCACTAGTTGCAATATCGGAAAGTTGGTACATTAGCAAGAGACAAAAGAGTACAGTTGTTGGTGAATTATGAGTCTGTGTCATGGTTTCATCCAAAT
GAGTAAGTCTATCAATCTAAGAGGATAACATGCACTAAAGCAACGAGAAAGTTGGGATTGATAGCCATGTGATTGCGAAAGCTTAAAAAAATACATGTGT
ACAAAGTGTTGTGTTGAGTCATAGTGCGTCCCTTGAGGACAAACAATGAATTTAAGTTGAGGGTATTGATGTATCCTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951445
Expected error %
0.475553
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149C03
Clone
Clone name
hba-149c3
LE_HBa0149C03
P149C03
Clone type
BAC
Contamination
none
Estimated length
135,987
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found