Clone Read LE_HBa0149C06_SP6_89578

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149C06_SP6_89578
Primer
SP6
ID from Seq. Facility
LE_HBa_149_C06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
516 trimmed for vector and quality, 829 raw
Sequence
>LE_HBa0149C06_SP6_89578 (raw untrimmed)
TTCGGGCAGACGCCCATTGGCTAGAGAGGTTCAGACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATCAGTAAGGAGGATTGTTGGCTTCTGTGGAG
GCAAGATCTTCCCTTTTTGACAAGATTAAGGAAAGACAATCTGATGATGAGAAACTGCGCAGAATTCAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAG
CACAAATCGATGAGGAAGGTGTTTTGAGGATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTC
AAGGTATTCTATACATCCGGGTGCAACCAAGATGTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGACTTTATTGCC
AAGTGTCCAAACTGTCAACAAGTAAAGTACGAACACCAAAGGCCCGGAGGAACACTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGCAA
TGGACTTTGTGGTTGGTCTTCCAAGGACAATGCGGAAGTACGACTCTATTTTTTTGATTGTTTTTTTTTTACACCCCTCCGCTCACCCCACCCTTGTTTA
TGTGATTTTCAATGCCGAGAAGTTAGCCAAGATCTATATCTCAAAAATCCTTCGGTTGCATGGGGGTTCCCCTATCCATCATATCCAATAGAGGTAACGC
TATTTACTTTTTTATTTTTGGAAAATTTTTGCATGCGGAAATGGGGTACTTGCGTGTAACCTTTAATTATTGCTTATCAATCTTTCATATGGATGGTCTA
TCATAATCAATCGATTTTTTTTTTTTTTG
>LE_HBa0149C06_SP6_89578 (trimmed for quality and cloning vector)
CCATTGGCTAGAGAGGTTCAGACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATCAGTAAGGAGGATTGTTGGCTTCTGTGGAGGCAAGATCTTCCC
TTTTTGACAAGATTAAGGAAAGACAATCTGATGATGAGAAACTGCGCAGAATTCAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAGCACAAATCGATGA
GGAAGGTGTTTTGAGGATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGATTTGATCAACACTATTCTGACAGAGGCTCATAGTTCAAGGTATTCTATA
CATCCGGGTGCAACCAAGATGTATCGTGACCTAAAGCAACACTTTTGGTGGAGTAGAATGAAGCGTGATATTGTTGACTTTATTGCCAAGTGTCCAAACT
GTCAACAAGTAAAGTACGAACACCAAAGGCCCGGAGGAACACTTCAGAGAATGCCCATTCCGGAATGGAAGTGGGAAAGAATTGCAATGGACTTTGTGGT
TGGTCTTCCAAGGACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971045
Expected error %
0.400731
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 222 E Value 3e-57 Identity 19.60% Align. Length 515bp (99.81%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 222 E Value 3e-57 Identity 19.60% Align. Length 515bp (99.81%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149C06
Clone
Clone name
hba-149c6
LE_HBa0149C06
P149C06
Clone type
BAC
Contamination
none
Estimated length
111,030
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found