Clone Read LE_HBa0149C06_T7_89579

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149C06_T7_89579
Primer
T7
ID from Seq. Facility
LE_HBa_149_C06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
305 trimmed for vector and quality, 885 raw
Sequence
>LE_HBa0149C06_T7_89579 (raw untrimmed)
CGCTCGAACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAAGGAACAACAAAGGAACTGACCGTTGTGGATTTATTGCTTTCTGTGTA
TTTGCTGTATTCTACTTTCTTGTAATCGTTCTTAAATTGTAGGATTCGTTTCAACTGTGATAGAAACGTTTCAACCTTGGGTGAATCATTGTAAGGGCTT
GGGTTACGGGTAACTTAGGCTTTTATGTTTGGGAGCAATGTTGTATCTGTTAAGGCTCAGCTAAGTGATAGGGAGTATTACTTAGTGTGGGATAATATCT
TGTTGTAACTGACTTCTACTTTTGCTTGTTGAATATTACTGAAAGTGGTTTGAAAATTCCTGTCTAAAAAAGGCCCTCGTTTTTTCTTTCTTTATTAATG
TTTTTTTTCTCCTTTGCCGCTTGTCAATCTTTCTTTCTTTCGTAATTATCCTCTTCTATTTTATATCTAATTTATCTTTGACCTGTAACTTTTTTTACAT
AGTCCACTTTTACTTTTCTTATCTTTTTGCTTTCTCTGGTTCCCTTCCTTCTTCCAGATTTTCTGGTGGCTGGTGCAATCTGTCTCTCCTCTCTCTTCTA
TATCTTTCTTACTTGTTTCTGTTTGCTATTTTTTTCATTTCTATTTTTTGTCTTATATAGTTTTCTCTCGTGTAAGGTTAATCTTGTTTTTTCTCTTTTT
TTGTTATATTTGTTTCTTCTTCGTCTTGTATTATTATACTAGTATTTTTTTTTGATACCTTAATCTCCCTCTTCTTTCTTCTTTCTTTTATTTTTCTGCT
ATAATTATGTCTCACTATCTTTCCCTCTTTTCCTCTATCTGCGTGCTCTACTACCTCTATGGCTAACGTGGGTTGTTAGTGTCCT
>LE_HBa0149C06_T7_89579 (trimmed for quality and cloning vector)
AGCTTCAAGGAACAACAAAGGAACTGACCGTTGTGGATTTATTGCTTTCTGTGTATTTGCTGTATTCTACTTTCTTGTAATCGTTCTTAAATTGTAGGAT
TCGTTTCAACTGTGATAGAAACGTTTCAACCTTGGGTGAATCATTGTAAGGGCTTGGGTTACGGGTAACTTAGGCTTTTATGTTTGGGAGCAATGTTGTA
TCTGTTAAGGCTCAGCTAAGTGATAGGGAGTATTACTTAGTGTGGGATAATATCTTGTTGTAACTGACTTCTACTTTTGCTTGTTGAATATTACTGAAAG
TGGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.904983
Expected error %
1.16192
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149C06
Clone
Clone name
hba-149c6
LE_HBa0149C06
P149C06
Clone type
BAC
Contamination
none
Estimated length
111,030
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found