Clone Read LE_HBa0149K17_SP6_89984

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149K17_SP6_89984
Primer
SP6
ID from Seq. Facility
LE_HBa_149_K17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
440 trimmed for vector and quality, 459 raw
Sequence
>LE_HBa0149K17_SP6_89984 (raw untrimmed)
TTGCGTTGTACTTTTTTTGAATCTCATCACACCCTTCATGGGTAAAATTTTCAAATAGACTCAATCATCAACATCATATTCTAGATCTCTCTTTCGAAAT
TCGGTGTAGGACTTTTGTTGAATTTGAGTTGTCTGCAACCCTTCTCTAGTGCGCCGAACTTTCTCCATAGCCTTATATACCAACTCAGGACCTATCAAAG
CAACCTCACCTACTTCAATCCAACTTATATGAGGACTAAGCCTCCAACAACAAAGAGGCTCAAATGAAGTCATATCAATGAGTGAATGATAACTATTATT
ATAAGCAAACTCAATTAAAGGCAATGATCATCCCAATGTCCTTTGAATTCAATCGCAAAAGCTCTCAACATATCCTCTAAAATTTGGATAGTACTCTCCG
CTTGATCATCGATTTGTGGATGAAAAGTCGTAGTAAACTTAATATGAGTACAAAGCCCA
>LE_HBa0149K17_SP6_89984 (trimmed for quality and cloning vector)
AATCTCATCACACCCTTCATGGGTAAAATTTTCAAATAGACTCAATCATCAACATCATATTCTAGATCTCTCTTTCGAAATTCGGTGTAGGACTTTTGTT
GAATTTGAGTTGTCTGCAACCCTTCTCTAGTGCGCCGAACTTTCTCCATAGCCTTATATACCAACTCAGGACCTATCAAAGCAACCTCACCTACTTCAAT
CCAACTTATATGAGGACTAAGCCTCCAACAACAAAGAGGCTCAAATGAAGTCATATCAATGAGTGAATGATAACTATTATTATAAGCAAACTCAATTAAA
GGCAATGATCATCCCAATGTCCTTTGAATTCAATCGCAAAAGCTCTCAACATATCCTCTAAAATTTGGATAGTACTCTCCGCTTGATCATCGATTTGTGG
ATGAAAAGTCGTAGTAAACTTAATATGAGTACAAAGCCCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952427
Expected error %
0.0423535
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 105 E Value 2e-35 Identity 55.40% Align. Length 436bp (99.09%) Frame 1
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 105 E Value 9e-35 Identity 55.40% Align. Length 436bp (99.09%) Frame 1
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149K17
Clone
Clone name
hba-149k17
LE_HBa0149K17
P149K17
Clone type
BAC
Contamination
none
Estimated length
86,548
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found