Clone Read LE_HBa0149O24_T7_90191

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0149O24_T7_90191
Primer
T7
ID from Seq. Facility
LE_HBa_149_O24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
415 trimmed for vector and quality, 793 raw
Sequence
>LE_HBa0149O24_T7_90191 (raw untrimmed)
AATTATTTTCAACACTCCATAACCGGCCCGGGTACTCCTTAGTCAACTGCAGGCATGCAAGCTTCCAAGATGAAAGGTGGATACAACCTATGAAGCATGA
AATCAATGCTCTTGAAGAAAATAAGACATGACAAGTAGTTGAGCTACCAGATGGCATGCATGCAGTTGGTTCCAAGTGGATATATAAAGTAAAATATAAG
GCAAATGGTGAGATAGAAAGGTTTAAAGCAAGACTTGTAGCAAAGGGATACAGCTAGCAGGAAGGACTGGATTATCATTACACTTTTTCTCCAGTAGCCA
AGATGGTAACAGTCAGATGTGTCATTGCATTAGCAGTATCAAAAGGCTGGACATTGTACCAGATGGATTTCTATAATGCTTTCTTACAGGGTGATTTAGA
TTAAGAGGTCTATATGAAAATGCCTGAAGGTTTTGCAAAACCAGGTGAAAACAAAGTCTGCAAGTTGTTGAAGTCTTTGTATGGACTTAAACAAGCCTCT
AGACAGTGGAACCTGAAACTTACAAAGGTAATACAAGCCACATGTTTTAGTCATAGTGCTCATGACTACTCACTGATCACTCTTACAAAAAGGGGGAAGA
TCTTCTTATTGTTTCACTTCATGGAACATCATTTATTTATCCCCTGAACTATCCATCAACTGACCGTAGACAATACCAGTATATCTAGCTTCTCCACTCC
AAACTATAAACAACCTTCATTCAGCTTAAACTTCTTCTTCACTCTTTTGAGCAGTTGAGATATCACACCTTTATACAATTATTTCATAATATT
>LE_HBa0149O24_T7_90191 (trimmed for quality and cloning vector)
ATGAAAGGTGGATACAACCTATGAAGCATGAAATCAATGCTCTTGAAGAAAATAAGACATGACAAGTAGTTGAGCTACCAGATGGCATGCATGCAGTTGG
TTCCAAGTGGATATATAAAGTAAAATATAAGGCAAATGGTGAGATAGAAAGGTTTAAAGCAAGACTTGTAGCAAAGGGATACAGCTAGCAGGAAGGACTG
GATTATCATTACACTTTTTCTCCAGTAGCCAAGATGGTAACAGTCAGATGTGTCATTGCATTAGCAGTATCAAAAGGCTGGACATTGTACCAGATGGATT
TCTATAATGCTTTCTTACAGGGTGATTTAGATTAAGAGGTCTATATGAAAATGCCTGAAGGTTTTGCAAAACCAGGTGAAAACAAAGTCTGCAAGTTGTT
GAAGTCTTTGTATGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937245
Expected error %
0.250035
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 140 E Value 3e-34 Identity 16.80% Align. Length 404bp (97.35%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 194 E Value 5e-49 Identity 23.30% Align. Length 407bp (98.07%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39941.1| Score 159 E Value 3e-38 Identity 22.30% Align. Length 344bp (82.89%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0149O24
Clone
Clone name
hba-149o24
LE_HBa0149O24
P149O24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found