Clone Read LE_HBa0150B09_SP6_90304

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0150B09_SP6_90304
Primer
SP6
ID from Seq. Facility
LE_HBa_150_B09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
304 trimmed for vector and quality, 880 raw
Genbank Accession
Sequence
>LE_HBa0150B09_SP6_90304 (raw untrimmed)
CAAAAAAATTTTGATCAAGGTTATTATATAGTGTTTTCTACGACATAACACATTTAAAAATCACATATGTAAGTGTGACTAAGACGTGTTCATTGCTGAA
ACGAACGAAACAATGAGAACCAAAAACAGGTCAAGGGTTGATTGTATGTCTTATATTGTCTAGGTATACACCAAAGCTCGATGGTTGAAAGATATAAAAT
CTGTCAATTGACCAAGTATATTCGATATATGTTCACTTTAGCAAGTTCAAATGGAAACCCACTTTATCCTGATGCAATCAATCCTTTCTTATAAATCATA
TAGTCTTTCATGCATACGTTTTAACAATATCATTCCTATTCATGTGGGGATTGCTGGGTTTCATTATTGTTTTCTAATAATGATTTGTTTTTTATTTCTT
CTTACCTTTTTTTCTTAAATCTATTCGCCTTTTTTTTTTTATCCTTTCCTCTTTTATCTTTTCTCTTTCTTACCTCTTCTTTTCTCTTCTCTTTTTCTTT
TTCTTTTTTTTATTTTCTATTTTTTAATTTTTTATTATTTAACTTTTATTTCCTTCGCATCTTTTTTCTCATATTCCCTATATAATTTATCATTTTTATT
TCCTTAATTTTTCTTCTCTTTTTTTTTATTTTTTCTTCATTTTTTTTTCTTTTCCGTATCTTTTTCATTTTCTTTTCTATTTCCATTATATTTTCTTTTT
TCTTTAACTATTAATATCTTCTTTTCTTTTCTTATATATTTATTTTCTCTTTACCATCTTTTCTTATCCATTTATACTTCTTCCTGTTTCTTTATGTATT
TGTTATTTTTATTTGTTGTCGTTCTTATTATTTTTTCATATTTCTATTCACTATTTATCTTTATTTATATTTTTTCTTTG
>LE_HBa0150B09_SP6_90304 (trimmed for quality and cloning vector)
AACACATTTAAAAATCACATATGTAAGTGTGACTAAGACGTGTTCATTGCTGAAACGAACGAAACAATGAGAACCAAAAACAGGTCAAGGGTTGATTGTA
TGTCTTATATTGTCTAGGTATACACCAAAGCTCGATGGTTGAAAGATATAAAATCTGTCAATTGACCAAGTATATTCGATATATGTTCACTTTAGCAAGT
TCAAATGGAAACCCACTTTATCCTGATGCAATCAATCCTTTCTTATAAATCATATAGTCTTTCATGCATACGTTTTAACAATATCATTCCTATTCATGTG
GGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.935575
Expected error %
1.03256
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0150B09
Clone
Clone name
hba-150b9
LE_HBa0150B09
P150B09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found