Clone Read LE_HBa0150J13_T7_90697

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0150J13_T7_90697
Primer
T7
ID from Seq. Facility
LE_HBa_150_J13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
560 trimmed for vector and quality, 855 raw
Genbank Accession
Sequence
>LE_HBa0150J13_T7_90697 (raw untrimmed)
ACCCGGGACCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGTAAATGTTACCAAAACGTACTCACCTATAAGAGTGTAAAGTTAATGAA
GACACCAGTCTCTATGAACACTCTAATGAAAGTATTTAGATTAACACACATAATACTAATGATGAGATGAGAAATCATCTATTGAGCTATGATGTCCTCA
TACTAGAAGCCAACTTCCATGACGTATGAGTTAGATGTAATGGAACTTTATACTGAGCACCGATAGACTATCTATGAGCGGTGATGTCTTCTTTCGAGAA
GGGCGGAGGTTCATGCAACTCTCATGAGATGAGACTGTCCGGCATACCAGGTATGGGTCTCCTTATATCTCCTAGTCTTCGAACCTATACTGCCAATATA
AGGATCTGCCGGGGTTCAATTCCCATGTACGCTAGCATGTTTTGGGTAACTTTGCCTCGTGATTCCACCTCTTTTCGGTGTGGTGTATCATGACATTGGA
TTTCATGATGCTCACATGATCTATGTCGGTTAAAGTTAAAGTTCCCAATGAATAAATAAGGTCAGCCTCAAATGATGCACATAATGAAACGAATGATACC
AAAGGTGTTATGATCGGATTACCCAGAGGTGAGTCCGACTCATTAATGGTCCTTAGGTCATTTCTTGGCCCTGCCCAACCAACCCATACGAAGGACTTAA
ACTACATCCTTTGGTTTATCTGGGGGTTTACCGGGGACCTTCAACGAAATTAATAAGAAGCACCTTTTGAATTGAATAAATTTCAGACTCTAATTTTTTT
CTAAATTCAATCTCCCCTCTTGTGATTGTCCTTCACTTTCCCTACGCTCTCCTTC
>LE_HBa0150J13_T7_90697 (trimmed for quality and cloning vector)
AGCTTAAGTAAATGTTACCAAAACGTACTCACCTATAAGAGTGTAAAGTTAATGAAGACACCAGTCTCTATGAACACTCTAATGAAAGTATTTAGATTAA
CACACATAATACTAATGATGAGATGAGAAATCATCTATTGAGCTATGATGTCCTCATACTAGAAGCCAACTTCCATGACGTATGAGTTAGATGTAATGGA
ACTTTATACTGAGCACCGATAGACTATCTATGAGCGGTGATGTCTTCTTTCGAGAAGGGCGGAGGTTCATGCAACTCTCATGAGATGAGACTGTCCGGCA
TACCAGGTATGGGTCTCCTTATATCTCCTAGTCTTCGAACCTATACTGCCAATATAAGGATCTGCCGGGGTTCAATTCCCATGTACGCTAGCATGTTTTG
GGTAACTTTGCCTCGTGATTCCACCTCTTTTCGGTGTGGTGTATCATGACATTGGATTTCATGATGCTCACATGATCTATGTCGGTTAAAGTTAAAGTTC
CCAATGAATAAATAAGGTCAGCCTCAAATGATGCACATAATGAAACGAATGATACCAAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.97329
Expected error %
0.245535
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0150J13
Clone
Clone name
hba-150j13
LE_HBa0150J13
P150J13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found