Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0007F24_SP6_91294

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0007F24_SP6_91294
Primer
SP6
ID from Seq. Facility
LE_HBa_007_F24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
708 trimmed for vector and quality, 779 raw
Sequence
>LE_HBa0007F24_SP6_91294 (raw untrimmed)
TTTCTTTTTTTTCGACAGCTCCCTCCACATGCTGTTTATGAGATGAAGCGCAAACTCTGGGAGTTGAAGCAGACGGGAAGCATCCTTTAAGAGGNGAAGG
AGNNNANAANNNNGANNCNCCAGACCCCTTAACGAACGGAAGATGACATGCTGTTCACCTTCATGGATGAGCTGCAGAATTGGGCGAGGACCGAGTTAGA
GCGGAGTCAAGTAAAAACCATCGATGAGGCCATCACTCAAGCCGAGACCTTGACAGATTTCAAACATGATCGTTTGGACAAGGCGAAGGGCAAGGAGGCA
CGGGGTAGTCAAGCTAAAGGCGGGGGAGACCATGGTCGTCGGGCGTGGCATGCCATCACAAAGATATTCATCTACTTTCAATTATCTATTCTTTAATGTT
TCTTCCTAACGGGGCTCTTTCACATCATTTTCATTACTTTTATAGTTCATACGATATTGAAATACTTTTTTATTTGTGCAAATATATATCTTATCATTAA
TTTGACATGTTTAAAAGTGTTTTCGAGCATTTCCGTATTTTTCTAACTTTTAATCATTATTTTTTAATTTATTTTTAGGCTTTTTAATTTTTTACATCTC
CTTTTAAAAATTAAAATTTATTAAATTTTTTATTTTAAGGTTCTCATATTTATTTGTGAATTTTCGGAGTTGATTTCATATTTTTTTTCGATATTTTCCC
TATTTTTATTAATTAATAACTAATTTTTTTTGGAATTTTCAAAAGAAAAATGTTAAAAAAATATTTTTTTTATAACTTT
>LE_HBa0007F24_SP6_91294 (trimmed for quality and cloning vector)
ATGCTGTTTATGAGATGAAGCGCAAACTCTGGGAGTTGAAGCAGACGGGAAGCATCCTTTAAGAGGNGAAGGAGNNNANAANNNNGANNCNCCAGACCCC
TTAACGAACGGAAGATGACATGCTGTTCACCTTCATGGATGAGCTGCAGAATTGGGCGAGGACCGAGTTAGAGCGGAGTCAAGTAAAAACCATCGATGAG
GCCATCACTCAAGCCGAGACCTTGACAGATTTCAAACATGATCGTTTGGACAAGGCGAAGGGCAAGGAGGCACGGGGTAGTCAAGCTAAAGGCGGGGGAG
ACCATGGTCGTCGGGCGTGGCATGCCATCACAAAGATATTCATCTACTTTCAATTATCTATTCTTTAATGTTTCTTCCTAACGGGGCTCTTTCACATCAT
TTTCATTACTTTTATAGTTCATACGATATTGAAATACTTTTTTATTTGTGCAAATATATATCTTATCATTAATTTGACATGTTTAAAAGTGTTTTCGAGC
ATTTCCGTATTTTTCTAACTTTTAATCATTATTTTTTAATTTATTTTTAGGCTTTTTAATTTTTTACATCTCCTTTTAAAAATTAAAATTTATTAAATTT
TTTATTTTAAGGTTCTCATATTTATTTGTGAATTTTCGGAGTTGATTTCATATTTTTTTTCGATATTTTCCCTATTTTTATTAATTAATAACTAATTTTT
TTTGGAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.982988
Expected error %
3.2843
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0007F24
Clone
Clone name
hba-7f24
LE_HBa0007F24
C02HBa0007F24
P007F24
Clone type
BAC
Contamination
none
Estimated length
181,384
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found