Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0007F24_T7_91295

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0007F24_T7_91295
Primer
T7
ID from Seq. Facility
LE_HBa_007_F24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
5 trimmed for vector and quality, 983 raw
Sequence
>LE_HBa0007F24_T7_91295 (raw untrimmed)
TCCCCTTTTTTTAAAAAGGGGGGGGGCCCCGCCCCGACCGCCCCAGAACCAAAAAGAACACCNGAGGAGGGCCCCCCTATAAAGGGGGGGGAAGAGAACA
GCACCAAGGGGGGGAAGNNAGGCCACACCNAGAACAAAAGGGACAGGNGGACAAAGGGAGGCGGGAGCAGCAGGGAGCCGACTCCCCAAAAGAGGAGGAA
AGAAGGAAGGAGAGACAAGAGGGCCCANCAGGAGAGGAGGAGAGAAGGGAANGAACGGAAGGAGCGAGCGAAACAAGAAGAAGAAGGAAGAAGAGGAAAG
AAGAGAGAGAAAGAAAGGACGGGGANGGAAGANAACGAAAAGACAAAAGGGGGAGACAA
GAAGAAGAGAGANCGAGAGAGAAGGAGAAAGCGGCGAGACA
AGGGGAGAGACNGCGCGCGACGAAAAAGGACCGCAGAAGAGGAGGAAGAAGACGGAGAGGAGACGGGAGGGAGAGGAAAACAGGGGAGACGAAAGGAGAG
AAGAAGGGAAAGAAGAGAAAAAGAAGAACAGAGAACGGAGGAACACAGAAAAAGAGAAAGAAAGAAGGGGAAGGAGGGGAAGCGCGGAGGGCGGAAGGAA
GAGACGAAGCAACAACGCGGAGAAGGAGAGAGAAAAGGAGGGAAGAAGAAGGGCAGAGGGGAGAGGAAGAAAGAAAGAGAGGAGCGCGAGAGCAAGAGAC
GANGAAGGGAGAGAAAGAAAAAAAGAGGAAAAGAGGAAGGGAGAGGAANGACCGCGAGAGGGAAGGCGGAGGGAGAGANGAGGAAGGAGACGGGAGACGA
GAGGGAGAAGAGAGAGAGGAGAGAGGGGGGGAGAGAACGGCAAGAGGAGAACCGAGCGACACGAAGAGAGGCAGAAGCGAGAGAGGGGAAGCAGAGCCAG
AGAGACAAAGAGGAGACGAAAGAGAAACGAAGGGAGCAGAGAGCNAAGGCGGAAAAGGCGAAAGAAAAGAGAAGAAAAAACAA
>LE_HBa0007F24_T7_91295 (trimmed for quality and cloning vector)
GAAGA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.860391
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0007F24
Clone
Clone name
hba-7f24
LE_HBa0007F24
C02HBa0007F24
P007F24
Clone type
BAC
Contamination
none
Estimated length
181,384
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found