Clone Read LE_HBa0007H12_T7_91367

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0007H12_T7_91367
Primer
T7
ID from Seq. Facility
LE_HBa_007_H12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
617 trimmed for vector and quality, 813 raw
Sequence
>LE_HBa0007H12_T7_91367 (raw untrimmed)
CTTCGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACAAAGAATCCTAAAGAGCCAAAGAAAGTGCGGTTGGAAATGGTCCATAT
AGATGTTTGGGGAACATCTCCAGTATCATCACTTGGAGGATCCAGATTCTATGTTACCTTCATTAATGATTTCAGCAGGATGGTATGGGTTTACTTCTTG
AAGCATAATTCAGATGTGTTTGCAATTTTCAAGAAGTGGAAAGCTGAAGTTGAGAATCAGACCGGTTTCAAAGTCAAATGCCTAAGGTCTGACAATGGAT
GAGAGTATGACAAATCAGAGTTCAAGGCATTTTGTCCAGCTGAGGGAATCAGATTGATGAGAATAGTTCTTGGTAAGGGAAGGCAGAATGGAATTGCTGA
GAGGATGAACAGAACATTGAGTGAGCGTGCAAGGAGTATGAGGATATACTGTGGGCTGCCCAAAACACTTTGGGCGGATGCTGTGAGCACAACTGCATAC
TTGATCAACAGGGGACCATCAGTTCCTTTAGGGTTCAAGATTCTAGAGGAGGTGTGGACAGGAAAAGAACTCAAGTACTCACACTTCAAGACTATTAGTT
GCACTACTTATGTTCATGTTGATCCAGAAAAGAGATACAAGCTTGATGCCAAGGCTGTGAAGTTGTACTTTCTAGGGAATAGGTTACTATTAGTTTGGTT
CAAGTTTTGAGGATGACATGAACATAAAAATCCCAACACATTCGAATCTAGACTATAGATAATGTTGTTCAGTCCCAGTATATACAATCCTTTTGTGTTT
CTTTTATCCCTTT
>LE_HBa0007H12_T7_91367 (trimmed for quality and cloning vector)
AGCTTCACAAAGAATCCTAAAGAGCCAAAGAAAGTGCGGTTGGAAATGGTCCATATAGATGTTTGGGGAACATCTCCAGTATCATCACTTGGAGGATCCA
GATTCTATGTTACCTTCATTAATGATTTCAGCAGGATGGTATGGGTTTACTTCTTGAAGCATAATTCAGATGTGTTTGCAATTTTCAAGAAGTGGAAAGC
TGAAGTTGAGAATCAGACCGGTTTCAAAGTCAAATGCCTAAGGTCTGACAATGGATGAGAGTATGACAAATCAGAGTTCAAGGCATTTTGTCCAGCTGAG
GGAATCAGATTGATGAGAATAGTTCTTGGTAAGGGAAGGCAGAATGGAATTGCTGAGAGGATGAACAGAACATTGAGTGAGCGTGCAAGGAGTATGAGGA
TATACTGTGGGCTGCCCAAAACACTTTGGGCGGATGCTGTGAGCACAACTGCATACTTGATCAACAGGGGACCATCAGTTCCTTTAGGGTTCAAGATTCT
AGAGGAGGTGTGGACAGGAAAAGAACTCAAGTACTCACACTTCAAGACTATTAGTTGCACTACTTATGTTCATGTTGATCCAGAAAAGAGATACAAGCTT
GATGCCAAGGCTGTGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.958612
Expected error %
0.478941
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA32025.1| Score 205 E Value 8e-52 Identity 17.00% Align. Length 575bp (93.19%) Frame 2
unnamed protein product [Nicotiana tabacum] sp|P10978|POLX_TOBAC Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Contains: Protease ; Reverse transcriptase ; Endonuclease]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK29467.1| Score 199 E Value 3e-50 Identity 16.70% Align. Length 593bp (96.11%) Frame 2
polyprotein-like [Lycopersicon chilense]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0007H12
Clone
Clone name
hba-7h12
LE_HBa0007H12
P007H12
Clone type
BAC
Contamination
none
Estimated length
90,898
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found