Clone Read LE_HBa0007H24_T7_91391

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0007H24_T7_91391
Primer
T7
ID from Seq. Facility
LE_HBa_007_H24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
535 trimmed for vector and quality, 788 raw
Sequence
>LE_HBa0007H24_T7_91391 (raw untrimmed)
TCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCTGCCAGCATGTATCATAGCGCCTCTTCCCCTCGCCAGTACCAAAAAGACCC
AACTATCTGCAAACCTTACATAAAAAAGGGAAGTGAAAAACATGTCTAATGAACAGAAAGTAGATCATGATCATACATTTGGACCTAAAAGTTTAGCCTT
TGTCATGTTTCAAAAGTAATAAAATAAGATGTGAGTCAAAAAAGATGAACAGATAAATGAACGATATTCACGTACTCCATGCAATTGACAAATGTGCATT
CACTAGACTCATAGATCTAAAGAAGCCACCAACATGACTCTTAACACATTCTAAACTTTCAACTTAGAATAATCATACCTACACACATGGTGCAAGAATA
TTTTCTCGAGTGAAAAAATCCCAAATTTCAACTCACGAAACTATGCTAATATATATTAAAAGTGACCCATTGTGTCACTATCACCAACAATTGAACTGGA
CCACAAGACTGCCTTTTTTTCCAATCTTTTACGATAAGAAAATGAAAAAAATCTTATGCCTTTTAACCCCCCTTCCCAAATCTATTCTTCTCTTAGTCCC
ACTTCCCCTGCATTGACAAGAGGATAACAAAAGGGAATTCGACCTACAGTCCCGACTAATTGAACAGTAACCACCAACTTATCTCAGAACAGTAATATAA
CAATGTTCTGTGATCCTACATTGACCTACCCAGCATTTTCAACTAGTTTATGTTTGTTCTTCGTTACTCGGCCCAGTTGTGAGTCTAG
>LE_HBa0007H24_T7_91391 (trimmed for quality and cloning vector)
AGCTTGCTGCCAGCATGTATCATAGCGCCTCTTCCCCTCGCCAGTACCAAAAAGACCCAACTATCTGCAAACCTTACATAAAAAAGGGAAGTGAAAAACA
TGTCTAATGAACAGAAAGTAGATCATGATCATACATTTGGACCTAAAAGTTTAGCCTTTGTCATGTTTCAAAAGTAATAAAATAAGATGTGAGTCAAAAA
AGATGAACAGATAAATGAACGATATTCACGTACTCCATGCAATTGACAAATGTGCATTCACTAGACTCATAGATCTAAAGAAGCCACCAACATGACTCTT
AACACATTCTAAACTTTCAACTTAGAATAATCATACCTACACACATGGTGCAAGAATATTTTCTCGAGTGAAAAAATCCCAAATTTCAACTCACGAAACT
ATGCTAATATATATTAAAAGTGACCCATTGTGTCACTATCACCAACAATTGAACTGGACCACAAGACTGCCTTTTTTTCCAATCTTTTACGATAAGAAAA
TGAAAAAAATCTTATGCCTTTTAACCCCCCTTCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.94112
Expected error %
1.79532
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0007H24
Clone
Clone name
hba-7h24
LE_HBa0007H24
C07HBa0007H24
P007H24
Clone type
BAC
Contamination
none
Estimated length
112,416
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found