Clone Read LE_HBa0007K09_T7_91505

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0007K09_T7_91505
Primer
T7
ID from Seq. Facility
LE_HBa_007_K09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 803 raw
Sequence
>LE_HBa0007K09_T7_91505 (raw untrimmed)
GCTCGGATCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCGGTAATGTCAAGGAGGGACCATAAGGACTAAACATGTACCCAAATGTA
CCATACCTGACCCTTTTCTGATGTTACAAGCCAAGAAAGCCCTATTGTGATCCTAGAGTCTAGTGTGGGGAACCTAACGCAGTTAAATAAGGGAAAGCCT
ATGTCAAAGATTACTAATTGTATTTGAACTTTTTCTTGAGCTTGAGTGTTGAAAAAAGATCCTTGTACCCAAATTCATGATCACTTTGTGAAAAATGAGT
TTTCTTTTGAAGTGAGGTCACTAGTTGCGGTATCGAAAAGTTGATACCTTGGTGAGAGGAAAATTAGTAGATGTTTATAGGCATGGTGAGTTTGTGGCAT
GATTTGATCCAAATAAGTTATCTGTTGAACCTAAAAGAGTGAGCCTGCACTAAATCAAAGAAAGACTTGGGGTTGATATCTATGTGATTGTTGGAGCTTA
AAAGCGTATACTTTTGTATAAATGTTGTTTTGATTCATTGTGCATTGATTGGGGACAAACAACAAATTAAGTTGAGGGTATAAATGTATCGTGGTCACAC
GGTGTTTTCAATGCATTTTGCTTAAGAGTTGTATGCGTCTAGAGCCTTTTTGTAGTAGTTTTAACATGTTTTTATGTTTGTTTTGCAGGGAAGATGTTTA
ATTGAAAAAGCAGAATGAATCCAAAAAATTCTTAGTACGTACTTTCAAGGAAAATTGACTGCCCTTTTTCTATTCATGGTCCCTAAGAAGTTGAGGGTTA
ACC
>LE_HBa0007K09_T7_91505 (trimmed for quality and cloning vector)
AGCTTAGCGGTAATGTCAAGGAGGGACCATAAGGACTAAACATGTACCCAAATGTACCATACCTGACCCTTTTCTGATGTTACAAGCCAAGAAAGCCCTA
TTGTGATCCTAGAGTCTAGTGTGGGGAACCTAACGCAGTTAAATAAGGGAAAGCCTATGTCAAAGATTACTAATTGTATTTGAACTTTTTCTTGAGCTTG
AGTGTTGAAAAAAGATCCTTGTACCCAAATTCATGATCACTTTGTGAAAAATGAGTTTTCTTTTGAAGTGAGGTCACTAGTTGCGGTATCGAAAAGTTGA
TACCTTGGTGAGAGGAAAATTAGTAGATGTTTATAGGCATGGTGAGTTTGTGGCATGATTTGATCCAAATAAGTTATCTGTTGAACCTAAAAGAGTGAGC
CTGCACTAAATCAAAGAAAGACTTGGGGTTGATATCTATGTGATTGTTGGAGCTTAAAAGCGTATACTTTTGTATAAATGTTGTTTTGATTCATTGTGCA
TTGATTGGGGACAAACAACAAATTAAGTTGAGGGTATAAATGTATCGTGGTCACACGGTGTTTTCAATGCATTTTGCTTAAGAGTTGTATGCGTCTAGAG
CCTTTTTGTAGTAGTTTTAACATGTTTTTATGTTTGTTTTGCAGGGAAGATGTTTAATTGAAAAAGCAGAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.94601
Expected error %
0.996216
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0007K09
Clone
Clone name
hba-7k9
LE_HBa0007K09
C06HBa0007K09
P007K09
Clone type
BAC
Contamination
none
Estimated length
122,589
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found