Clone Read LE_HBa0029A19_T7_91813

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029A19_T7_91813
Primer
T7
ID from Seq. Facility
LE_HBa_029_A19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
376 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0029A19_T7_91813 (raw untrimmed)
CCCGGGACCCGGGGGATTCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGTATTTTGTACATCCTTTTTCCATTTTTTGATCGATATACTTTCTTATA
ATTTTGTTTTCTACCTTAATATCTTGTGTCCTATATGAAAATTAGTTATATACAATTCATGTTCTCCTATATTTCTTAATCATTGATGAAATTCATAATG
AAAGATTAATCAGTTAATTTTTATTTGCGACTATCTATAGAGTGTTTTACTTTAGTTTAAATATATTTTTGAGATTATTATTTATTAGTAATGAGAGGAA
TAACTAAATGAAAAAAATCACATATGATTTTTTTAAATGTTTTTTTATTTGACTTTTCGTTTATACTGTATAATCTATCGATCTTATCAGTTTATTATTT
GTTTGTGGAAACATTCATTCTTCAAATTTTACCATTTATCTAGAATAACTCCTTTTGAAAATGTTTTGGTTGCTCCATTTATATAAATTGATCAAATCGT
AAATTTTATAAAAAGTGAGAGTATTATACATTTTCTACTCATAATCACATGATAATTTTTCTATAATGTTTACAGAAAGCATGAATTTCGAGACGAAACC
AAGTCAAATACATAACATAATACCCTATATAAGATGGCACTTAGTGGATCTATAGTATCTATATACATTCCTCTCTTTATTCTTTTGTCTATTTCCTCTA
TCCTTCCTTTAATCTACTTCTACATGTCTCCTTACTCTTTTACTCTTTTACCACTATACTTTCCCCATTTACCCTTTCCGCTGAACCTCCCTCCCCCTTA
CATCTTTAACCATGCACCCTTT
>LE_HBa0029A19_T7_91813 (trimmed for quality and cloning vector)
AGCTTAAGTATTTTGTACATCCTTTTTCCATTTTTTGATCGATATACTTTCTTATAATTTTGTTTTCTACCTTAATATCTTGTGTCCTATATGAAAATTA
GTTATATACAATTCATGTTCTCCTATATTTCTTAATCATTGATGAAATTCATAATGAAAGATTAATCAGTTAATTTTTATTTGCGACTATCTATAGAGTG
TTTTACTTTAGTTTAAATATATTTTTGAGATTATTATTTATTAGTAATGAGAGGAATAACTAAATGAAAAAAATCACATATGATTTTTTTAAATGTTTTT
TTATTTGACTTTTCGTTTATACTGTATAATCTATCGATCTTATCAGTTTATTATTTGTTTGTGGAAACATTCATTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.852796
Expected error %
1.09777
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029A19
Clone
Clone name
hba-29a19
LE_HBa0029A19
P029A19
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found