Clone Read LE_HBa0004D04_T7_919

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004D04_T7_919
Primer
T7
ID from Seq. Facility
LE_Hba_004_D04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
821 trimmed for vector and quality, 1138 raw
Genbank Accession
Sequence
>LE_HBa0004D04_T7_919 (raw untrimmed)
TTAACTGGGTCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTACCCCTTCACTTAGATAGTTACCATTTGATGAAATGACTAGTAGATA
AGCAGGAATCACTTCTGCCTTCCACATGTTGAAAAAAGTAAAAGGCCCTGAGACCAAAATAGACAATTTGACCTCAAGGAGATATAAGCTCTGCTCTAAG
GATAAATGCAGAACAGAAGACCTTCTTGTGGATGGCCTGTATGTGCTCTTTTTTTTCTTTTTTTTTGGAACTATCGATATCATGAGTGCAAAGAATACTA
CCTTGCGGAGAATTTTCCAGATCAATAGCAGGACAGCTAGTATTATTGCCTTAAACTGTGTTTAGATTGAGCAAACGATGTTAACTAGTCATGCAGATGC
TTTTTTCAGCTTCTAGTGATGATACCAGCATGGGTAACTTTGTGTAGTACTAAAGGATTTAAGTTTCTGTAATGTTTCGGAAGTTCTCTGCAAAGAATAA
ATCTGTTTCATCATCATTTCATTTAGATTATAATGTGAACTCCTCCCTTTCAACAACAGTAAAATTGGTGGCAAGAACATGACTTTTGGTTTTTGTCCTC
ATGATAATGGATGTTCTTATTCCCTTACATTTTTCTTTGTTGTAAATAGAATTGCAAAAGATCCCCGATTCGAAAGGCTTCCCTGTACTCACAAAGGGAC
ATATGCCGATGATTGTATTGTTGAGAGAGTTACACAGGTATGATCTTAATCCATTGTGCATAATGTTCTCTGAAGTTGTTAGTTGTGTAAACCAATTTGT
AATCCTACTGCATGTATGGATGATTTCATTCCTCTACAGCACAAGTGCTATATTGTCGCAACATGTGATCCAAGATTGAAACGTAAAATACGCAAGGGAT
GAAAGATTAGCTCATATCCTCCTTTTCCGAACCCTTTTCTCTCTTCTGCTGTTTTACTATTGTATTTTGTTCCTTCTGGATATATTTATAAAAAAAACTG
ACTTTTAAGTTGAAAGTCATGGCCCTGGGGTTCTATCATTTTCTTCTTCCAACATATAACTTATTGAAGGGTTGCTGTAATAACAATTGTTGGAGGAAAG
GCTAACTCTATCTTTTATTTGTTCCTTCTAAAGTATGA
>LE_HBa0004D04_T7_919 (trimmed for quality and cloning vector)
AGCTTTACCCCTTCACTTAGATAGTTACCATTTGATGAAATGACTAGTAGATAAGCAGGAATCACTTCTGCCTTCCACATGTTGAAAAAAGTAAAAGGCC
CTGAGACCAAAATAGACAATTTGACCTCAAGGAGATATAAGCTCTGCTCTAAGGATAAATGCAGAACAGAAGACCTTCTTGTGGATGGCCTGTATGTGCT
CTTTTTTTTCTTTTTTTTTGGAACTATCGATATCATGAGTGCAAAGAATACTACCTTGCGGAGAATTTTCCAGATCAATAGCAGGACAGCTAGTATTATT
GCCTTAAACTGTGTTTAGATTGAGCAAACGATGTTAACTAGTCATGCAGATGCTTTTTTCAGCTTCTAGTGATGATACCAGCATGGGTAACTTTGTGTAG
TACTAAAGGATTTAAGTTTCTGTAATGTTTCGGAAGTTCTCTGCAAAGAATAAATCTGTTTCATCATCATTTCATTTAGATTATAATGTGAACTCCTCCC
TTTCAACAACAGTAAAATTGGTGGCAAGAACATGACTTTTGGTTTTTGTCCTCATGATAATGGATGTTCTTATTCCCTTACATTTTTCTTTGTTGTAAAT
AGAATTGCAAAAGATCCCCGATTCGAAAGGCTTCCCTGTACTCACAAAGGGACATATGCCGATGATTGTATTGTTGAGAGAGTTACACAGGTATGATCTT
AATCCATTGTGCATAATGTTCTCTGAAGTTGTTAGTTGTGTAAACCAATTTGTAATCCTACTGCATGTATGGATGATTTCATTCCTCTACAGCACAAGTG
CTATATTGTCGCAACATGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959807
Expected error %
0.531837
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g46230.1 Score 65 E Value 6e-11 Identity 15.40% Align. Length 227bp (27.65%) Frame 2
68415.m05749 expressed protein contains Pfam profile: PF04900 protein of unknown function, DUF652
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004D04
Clone
Clone name
hba-4d4
LE_HBa0004D04
C03HBa0004D04
P004D04
Clone type
BAC
Contamination
none
Estimated length
130,926
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found