Clone Read LE_HBa0029I02_SP6_92162

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029I02_SP6_92162
Primer
SP6
ID from Seq. Facility
LE_HBa_029_I02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
427 trimmed for vector and quality, 965 raw
Genbank Accession
Sequence
>LE_HBa0029I02_SP6_92162 (raw untrimmed)
TGGGCGAGTTTTGCTAAAACGTTCAACAAAGTCGAAGACATTCGAAAGTTAGCCCTTGAGACGTCCAAATGTGTCCTTTTGGGGCCTAGCATGTTTCGAC
GTGTTTTGTGTATTTCTTTTTTGTTAAACTTATGTTGGAGGTCTAAAACTTTTTAAGGATTGTATCTACGTTGATAACATCCGGGTACGACTTCTAAAGG
GCCCCACAAAAAGGGCCCACAAGAAGGCCACAAGGTTGGTCGAGACACTGCCTTGGCAGTGTCAATCGACTGAACGAAATGACGGCAAGTTGGTTGAACA
ACAGTCCGTTGGTTAGTTCTCGTTGATGCAAACTTAGCCTGGTCAAGTCTCAACCCAAAAATTGCCAGGGTCCAATTGACGAAAGCCACAACCAGCCAGT
CAACTGACCAATGGCCCGTCGATGGTGGCCTGTAACACTACCTTTGCGACTGTTTTATTTAAGGGGTTTTTAGGAAATTCACCCCATGTCCTAACCTGAA
TCTAATTGAAAAATATGGCTATTTTTCATATATTTAAGGAATAAAACATGTGAACAATCCATTCCCAATCCCTTCTCACGAAATTGAACATTTTATTCCA
AACATATTTTCTTTACAAACTTCCATTGTTTTTGTACCTCAAGAACAGCTTCCAGATAGAGAATTCTCTGGAATATTCCCCGTTAAGGGGTTACACCCGA
AATACGCACTATTTAGTCCAATAATTTGGTCATCACAACTCTCCTCTCATTACGTTTTATAAACAAAGTCCACATTAATCCTTATTTCCTAACTCTTTTT
CTTCATACTTCTATTGAATCTTTGTTCTCTTTTCCTCTCTCTATATTTTGACCTTTTTTTTCATTTATACTTACTCTTTTGATATTCTATTTTTTCTCTT
TTTTTTGCTACTTCTATCTAAATAAATTTTTCCTAATATAGTCATTCTAGCTATTTGTATTATTG
>LE_HBa0029I02_SP6_92162 (trimmed for quality and cloning vector)
TTCGAAAGTTAGCCCTTGAGACGTCCAAATGTGTCCTTTTGGGGCCTAGCATGTTTCGACGTGTTTTGTGTATTTCTTTTTTGTTAAACTTATGTTGGAG
GTCTAAAACTTTTTAAGGATTGTATCTACGTTGATAACATCCGGGTACGACTTCTAAAGGGCCCCACAAAAAGGGCCCACAAGAAGGCCACAAGGTTGGT
CGAGACACTGCCTTGGCAGTGTCAATCGACTGAACGAAATGACGGCAAGTTGGTTGAACAACAGTCCGTTGGTTAGTTCTCGTTGATGCAAACTTAGCCT
GGTCAAGTCTCAACCCAAAAATTGCCAGGGTCCAATTGACGAAAGCCACAACCAGCCAGTCAACTGACCAATGGCCCGTCGATGGTGGCCTGTAACACTA
CCTTTGCGACTGTTTTATTTAAGGGGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976903
Expected error %
0.418426
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029I02
Clone
Clone name
hba-29i2
LE_HBa0029I02
C10HBa0029I02
P029I02
Clone type
BAC
Contamination
none
Estimated length
94,384
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found