Clone Read LE_HBa0029I02_T7_92163

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029I02_T7_92163
Primer
T7
ID from Seq. Facility
LE_HBa_029_I02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
723 trimmed for vector and quality, 780 raw
Genbank Accession
Sequence
>LE_HBa0029I02_T7_92163 (raw untrimmed)
ACTCGGTCTCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTTCCAGTACATTTTCAACTTCTTCATAGCCCACATGTCTTTATGCTATA
ATTCAACGGGAAGATGACAAGCTTTCCCATATGCAAGTTGGTATGGGGAAATACCTATGGGAGTCTTATACGCTGTCCGGTACGCCCAAAGAGCATCATC
AAGCCTCCTTGACCAATCCGTTTTACTAGCATTCACTATTTTTGACAATATCTGTTTGATCTCCCTATTTGACACTTCAACTTGCCGACTAGATTGAGGA
TGGTAAGGAGTGGCCACATTATGGCGAACCCCATATTTTTCTAATAATCCCTTGAAAAATCTGTTGCAAATGTGGGAGCCCCCATCACTAATAATTGCCC
TTGGGGTGCCAAAACGAGAGAATATATTCTTTTTTAAGAACGCAGTGACACTCTTCCCTTACTTGTTTGCGGGGGTGATAGCTTCCACCCATTTAGATAG
ATAATCAACCGCTGCTAAAATATACTTCATTCCATGATAACTCACAAAAGGACCCATAAAGTCAATACCCCAAACATCAAATAACTCAATCACAAGAATG
GGGTTTAGAGGGAGCTCTTGCTTTCTTGAAATTCCTTCATCTCTTTGGCATCTATCACATGCTTTAACAAAATGAGGAGCATATTGATGAAGAGTTGGGC
AATAGTAACCACATTGTAATAATCTTATGAGTGGTTCGGATACCACTATGATGTTCCCCAATTGGGGTGAGGAATGGCAC
>LE_HBa0029I02_T7_92163 (trimmed for quality and cloning vector)
AGCTTCGTTCCAGTACATTTTCAACTTCTTCATAGCCCACATGTCTTTATGCTATAATTCAACGGGAAGATGACAAGCTTTCCCATATGCAAGTTGGTAT
GGGGAAATACCTATGGGAGTCTTATACGCTGTCCGGTACGCCCAAAGAGCATCATCAAGCCTCCTTGACCAATCCGTTTTACTAGCATTCACTATTTTTG
ACAATATCTGTTTGATCTCCCTATTTGACACTTCAACTTGCCGACTAGATTGAGGATGGTAAGGAGTGGCCACATTATGGCGAACCCCATATTTTTCTAA
TAATCCCTTGAAAAATCTGTTGCAAATGTGGGAGCCCCCATCACTAATAATTGCCCTTGGGGTGCCAAAACGAGAGAATATATTCTTTTTTAAGAACGCA
GTGACACTCTTCCCTTACTTGTTTGCGGGGGTGATAGCTTCCACCCATTTAGATAGATAATCAACCGCTGCTAAAATATACTTCATTCCATGATAACTCA
CAAAAGGACCCATAAAGTCAATACCCCAAACATCAAATAACTCAATCACAAGAATGGGGTTTAGAGGGAGCTCTTGCTTTCTTGAAATTCCTTCATCTCT
TTGGCATCTATCACATGCTTTAACAAAATGAGGAGCATATTGATGAAGAGTTGGGCAATAGTAACCACATTGTAATAATCTTATGAGTGGTTCGGATACC
ACTATGATGTTCCCCAATTGGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.975046
Expected error %
0.876347
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF24531.1| Score 286 E Value 4e-76 Identity 20.30% Align. Length 659bp (91.15%) Frame 2
F7F22.17 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF24529.1| Score 285 E Value 1e-75 Identity 20.20% Align. Length 659bp (91.15%) Frame 2
F7F22.15 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029I02
Clone
Clone name
hba-29i2
LE_HBa0029I02
C10HBa0029I02
P029I02
Clone type
BAC
Contamination
none
Estimated length
94,384
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found