Clone Read LE_HBa0029I24_SP6_92206

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029I24_SP6_92206
Primer
SP6
ID from Seq. Facility
LE_HBa_029_I24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
458 trimmed for vector and quality, 907 raw
Genbank Accession
Sequence
>LE_HBa0029I24_SP6_92206 (raw untrimmed)
GTGGCCAAATTTCTCTAAAGTTGTGAGTTATTGGCTAGATTAAGTGTCCTTCTTAGGACACGTAGTTTCTCTTGACGGGGGGAAGGNGGATCCTTCCAAG
ATTGAAGCAGTTTAGAATTGGGTAAGGCCTACCAATGTTACAGAGGTAAGGAGCTTTGTTGGTTTAGCTAGCTACTACCGTCGATTTGTCAAGGGATTTT
CTTCTGTTGCTTCCTAACTGACAAATTTGACTAAGCAGAGTGTTCCATTTGTATGGTCGGACGAATGTGAAGAAAGTTTTCAGAAACTCAAGACTTTGTT
GACTACTGCACCAATTCTCACCTTGCCAGTGGAAGGAAAGAACTTCGTTGTTTACTGTGATGCATCCTATTTTGGTTTGGTGCAGTGCTAATGCAAGAGA
AGAGTGTAATTGCTTATGGTTCGAGGCAACTAAAGGTGCATGAACGTAATTATCCTACCCATGATTTGGAGTTGGCTGCGGTTGTGTTTGCATTAAAGCA
ATGGAAACATTATCTATATGGGGTGAAGTGTGAAGTCTATACAGATCATCGTAGTTAACAGTAAGTCTTTACACCAAAAGATTTAAATTTGAGACAAAAG
AAGTGGATAGAACTTCTGTAGGAATAATAATGACATTATCTGGTTCAACGCCAAAAAGAGGCAAGAGAGGGGCCGACGCCTTAGATGACGAAGATGGGGA
TGGAGTGTGTCAGTTATTCTTTTTGATATTACATAGTAAGGGCTTTAGGATGTTGACCCCGTGAAAGAGAAAGTAATGGGGTGATATGGAAAAGAAGAAG
AGTAGGGTGTATGTTTGTAGTGCAGTGAATTATGGCGCGGCAGTTGGGTGATATTGCTGTCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNN
NNNNNNN
>LE_HBa0029I24_SP6_92206 (trimmed for quality and cloning vector)
GGCTAGATTAAGTGTCCTTCTTAGGACACGTAGTTTCTCTTGACGGGGGGAAGGNGGATCCTTCCAAGATTGAAGCAGTTTAGAATTGGGTAAGGCCTAC
CAATGTTACAGAGGTAAGGAGCTTTGTTGGTTTAGCTAGCTACTACCGTCGATTTGTCAAGGGATTTTCTTCTGTTGCTTCCTAACTGACAAATTTGACT
AAGCAGAGTGTTCCATTTGTATGGTCGGACGAATGTGAAGAAAGTTTTCAGAAACTCAAGACTTTGTTGACTACTGCACCAATTCTCACCTTGCCAGTGG
AAGGAAAGAACTTCGTTGTTTACTGTGATGCATCCTATTTTGGTTTGGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGCTTATGGTTCGAGGCAACTA
AAGGTGCATGAACGTAATTATCCTACCCATGATTTGGAGTTGGCTGCGGTTGTGTTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975762
Expected error %
1.15617
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 138 E Value 5e-45 Identity 59.10% Align. Length 454bp (99.13%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 134 E Value 2e-44 Identity 58.30% Align. Length 454bp (99.13%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029I24
Clone
Clone name
hba-29i24
LE_HBa0029I24
C10HBa0029I24
P029I24
Clone type
BAC
Contamination
none
Estimated length
115,517
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found