Clone Read LE_HBa0029I24_T7_92207

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029I24_T7_92207
Primer
T7
ID from Seq. Facility
LE_HBa_029_I24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 1147 raw
Sequence
>LE_HBa0029I24_T7_92207 (raw untrimmed)
GCTGTAGTTCGCTGGTGCGTAGTGAGAATCTGGACGGGGGGTATATGTTGGGTAGTAATAGGTGGCAATGCAAAGGAAAAGCAAGAGGGGGAAGCGGTGG
GATATGGGCGACGTCCCCGTTTGAGAGATGTGTGGTAGGAAAGACAGAAACGCTGGACAGTGGTGAGAAGGGGCCCCTTTAAGAGAGGCGCGGAGCAAAG
GGATAGAAGGTGTAGCGAGCATAGAAAGTGAGAATAGAAGAAAGGAAGGACGTGTATAAGTACAGTCGGAAGACACGCCGTTGTCCCCGCAAGCATGGAC
CATACGGAATGTAGACATCAGTGAGGTGGCGTGATCTGGTCGGAAGCGCCATGTGGGAGCGTGGTGAAACTGATCAAAACGCACACGGAGGAGATCAGTG
ATAGACAGACATTATAAAACATGCGAATGAGATAACGCATGTGTTAAGGGACAGTAATTAGAGAGTCACGTTTTAGTAGGAAACTATAGAGACACTGCAT
GAGGACAGCAATGACGGGGACGATATAGACGACCTAGGTCCTGCGGAGACATGGATTGAGGTGGATCCCATTGGACGGTTGCGCCCTGTCTCAAAGTCAC
CATACAAGAGCTGTTTGCGATACCTGGGCATATCAAAGCTGAGTATAAGTAGAGAATAGTGATTGAGTAGTATATTTATTAACGAGCGATGGAAAGAACC
CGCATGAAGACGACAATAGAAAACGCAGAATATATGAGAGCGATCCTACGGTGGAATTTTAGTTACGTCGGAATCAATCTTTAAGTCGGGTCCTGATTAA
ATAGTCGTCGAGCTGTCCTAGTAGGCGTCCTGAAAAGTGGTTAGATAGTAACGGGGCCGCAGAGTGAAGGAACACGGTTACGAATGTAAGAGTTGCGTGA
GAAAAAGAAAGAAGAAAATTGGAGGGAAAAAAAAGGGCGGATATAGTTCAGTCCAACGAGCAACGCGGGACATACTAAAGATACTATGAGGGGAGAGGGT
GGACAAAGAGGAGAAAGGATAACAGTACGTAAAGGTGGAAGGGTCAGTAAAGAGAGTATGATGTGATAGAAAAAGTGAAAGGAACTCATGTGTTAATGAC
TGGCGGTATCTATAGAGCACGCGATGGTGGGGGCGTGGTCGGAGAGG
>LE_HBa0029I24_T7_92207 (trimmed for quality and cloning vector)
GGG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • High predicted error rate
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
3.50079
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029I24
Clone
Clone name
hba-29i24
LE_HBa0029I24
C10HBa0029I24
P029I24
Clone type
BAC
Contamination
none
Estimated length
115,517
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found