Clone Read LE_HBa0029M12_T7_92375

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029M12_T7_92375
Primer
T7
ID from Seq. Facility
LE_HBa_029_M12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
590 trimmed for vector and quality, 831 raw
Genbank Accession
Sequence
>LE_HBa0029M12_T7_92375 (raw untrimmed)
CCTGGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATAAATGCAATCAATTGGAGAACAATGTCAAGTCTTCCTTAGATTATCTG
CCGCAAACAGCAGATCGATGGCATGACCCTTGCTTCTTTTGTCTGTAAATTGCGAGCAAAGGTAAGTTCATCGTCTTCTACTAAGGTTGCCAGGTTGCAT
TCGGGCAAAGCTCCAAGTAAAGCTATGTCTGGAGATCACTGTAGCAGATCTTGTATATCTGGTGGTCATGATGGGATGGAGAAGAGAAGTAAACAAGAAT
GCACCAGTTCCAATCAGACATCAGGGACTAAAGTAGAGGATGACATGCCCCTCTCTTCTTTCATTGGCAGAGTGAAGAAAAGGGAGTGTACTGAAGTAGG
GGATGACATGCTTCTCTCTCTCTTTGTGGGCAGATTGAAAAGGGAGCGACACTAATTTCTTTTTATAGATTTCCAAGGCTGCATATTATTCTCTGAAGCT
ATGGTATGGGCCAAAACTGATTCATCCTATCTTCATCTTGGATGCATACATCTACATTGCACAAAAAATTTCAGGTTGCTGGGGGAAACCTAATGAGGTT
CACTTGTATATGCGATCACCATTGGGAAAAGTTTTTCTTTATTTCCCTCTCGGATATATCAACTTATAAGATTTTCTCACTTCATTTTGTGTACTTCTAA
TATTATGAATTCATTTTTTTCTATAATTTTTTTAGATACTCCTTCATCAATTTCTTATTCCTCCACTGGCAATACACTGCAACCATTCCTTTCACGTACA
TACGTATCATCTTCACATTTTGTAATTGTAA
>LE_HBa0029M12_T7_92375 (trimmed for quality and cloning vector)
AGCTTAATAAATGCAATCAATTGGAGAACAATGTCAAGTCTTCCTTAGATTATCTGCCGCAAACAGCAGATCGATGGCATGACCCTTGCTTCTTTTGTCT
GTAAATTGCGAGCAAAGGTAAGTTCATCGTCTTCTACTAAGGTTGCCAGGTTGCATTCGGGCAAAGCTCCAAGTAAAGCTATGTCTGGAGATCACTGTAG
CAGATCTTGTATATCTGGTGGTCATGATGGGATGGAGAAGAGAAGTAAACAAGAATGCACCAGTTCCAATCAGACATCAGGGACTAAAGTAGAGGATGAC
ATGCCCCTCTCTTCTTTCATTGGCAGAGTGAAGAAAAGGGAGTGTACTGAAGTAGGGGATGACATGCTTCTCTCTCTCTTTGTGGGCAGATTGAAAAGGG
AGCGACACTAATTTCTTTTTATAGATTTCCAAGGCTGCATATTATTCTCTGAAGCTATGGTATGGGCCAAAACTGATTCATCCTATCTTCATCTTGGATG
CATACATCTACATTGCACAAAAAATTTCAGGTTGCTGGGGGAAACCTAATGAGGTTCACTTGTATATGCGATCACCATTGGGAAAAGTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966232
Expected error %
0.781242
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029M12
Clone
Clone name
hba-29m12
LE_HBa0029M12
C03HBa0029M12
P029M12
Clone type
BAC
Contamination
none
Estimated length
106,385
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found