Clone Read LE_HBa0038C11_SP6_92660

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0038C11_SP6_92660
Primer
SP6
ID from Seq. Facility
LE_HBa_038_C11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
521 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0038C11_SP6_92660 (raw untrimmed)
CGGTTTATGCCACGTTCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAACGATGGAGTGATGGTGGATCCTTCTAA
GATTGAGACAGTGAAGAATAGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTC
TCTTCTATTGCCTCCCAACAGACGAACTTGACTAAGCAAAATGTTTCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTCTGT
TGACTACTGCACCAATTCTCACCTTGCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTTTAGGTGCAGTGCTAATGCAAGA
GAAGAATGTGATTGCTTATGCTTCAAGACAATTAAAAGTGCATGAACGTAACTATCCAACTCATGATTTGGAATTGGTTGCGGTAGTGTTTGCATTAAAG
CAATGGAGACACTATTTATATGGGGTTAAGTGTGAGGTCTACACGGATCATCCTAGCCTTCAGTATGTCTTTACCCAGAAAGATTTGAACTTGAGACAGA
TGAGATGGATGGAGCTACTGAAGGAATACGACCTCACTCTTTTGGTCTCTCCCGGGAAGGCGAATGCCTTCGCTATGCTTTCTATCTAAAGGCCTGTAAG
CATTTGGATTTCTACTCTCTTTGCTTTCTTATTACCACCTCATCTTGCTAATCAATTTTACATTTTTGATAATAACTCCTTGAATTTTAAAATTATTATA
ATTGGCTGGTTTTGCCATCTAA
>LE_HBa0038C11_SP6_92660 (trimmed for quality and cloning vector)
GTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAACGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAGAATAGG
GTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTGCCTCCCAACAGA
CGAACTTGACTAAGCAAAATGTTTCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTCTGTTGACTACTGCACCAATTCTCAC
CTTGCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCCTATTCGGGTTTAGGTGCAGTGCTAATGCAAGAGAAGAATGTGATTGCTTATGCT
TCAAGACAATTAAAAGTGCATGAACGTAACTATCCAACTCATGATTTGGAATTGGTTGCGGTAGTGTTTGCATTAAAGCAATGGAGACACTATTTATATG
GGGTTAAGTGTGAGGTCTACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969666
Expected error %
0.0737531
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 241 E Value 9e-63 Identity 21.80% Align. Length 518bp (99.42%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 240 E Value 1e-62 Identity 22.00% Align. Length 518bp (99.42%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0038C11
Clone
Clone name
hba-38c11
LE_HBa0038C11
P038C11
Clone type
BAC
Contamination
none
Estimated length
113,168
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found