Clone Read LE_HBa0038I12_T7_92951

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0038I12_T7_92951
Primer
T7
ID from Seq. Facility
LE_HBa_038_I12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
656 trimmed for vector and quality, 940 raw
Genbank Accession
Sequence
>LE_HBa0038I12_T7_92951 (raw untrimmed)
CGAAATGGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAGTATAAGATTGAAATTTGGGAATTGTGAATTTGGATAAACCCTAG
ATTGGAATCGATAGATTCTCTATCCATTTACGTAAAATTCAAGCTCAATTTCTACAGTAACGCCCAAATTCACTGCATTTTCTCTCTCATCCCCTATAAA
CTCGATGCAATTTCGCAGGTTCTACACCTCTCTAGCGAATTCTAACCGCAACCCATTTCTCCTATATCGAAATCTCACAAACCCTTTTGCTGTTTTCGAC
CCTAACCCACAGTTTCTCTCTACACAAAGAATCTTGAAAAACTGGGTTCAAAGGCCAATTCGTGTGTCGAAACGTTTTGTCTCATCATTTCCTGCTATGG
CAGAAGGAAGAAGACCCACTCATGTGCCTATACCACCCCCAGAAACTGCTGATAAGGCGGAATTGTATCGAGCACTTGAGGCTGCGGTGGGGTCGCAGTT
TAGTTCAGAGCCATTGGCACCGGAGCCTCATCCTTTGATTATTGTGGTTAGTGGTCCAAGTGGGGTTGGTAAAGATGCTGTGATTAAAAGGCTTAGAGAA
GTTAGGGAGAATATTCATTTTGTTGTTACTGCAACGACAAGGGGGAAAAGGCCGGGTGAGGTTGATGGAAAAAATTACTTTTTTACGAGTAAAGAAAAGT
TTTTGTAATGAATTACAACATTATTTGTTGGAGTATGAATTGGTGTATTGGGAAATAAAGGGTAAACCCAAGACACAAATAAGGATCAAATGGACAAATA
TTTGAATATTTGGTTGTATAGTATAATAAAATGGTCCGCACACAATAAATATTTTAAAAATTCCCAGTGTTTTATTTTATGGAGAGAAAGTTAGATCTAT
AATTAAAGCTAGTTTCCTACCTATCGATTACATATTCTCT
>LE_HBa0038I12_T7_92951 (trimmed for quality and cloning vector)
AGCTTGCAGTATAAGATTGAAATTTGGGAATTGTGAATTTGGATAAACCCTAGATTGGAATCGATAGATTCTCTATCCATTTACGTAAAATTCAAGCTCA
ATTTCTACAGTAACGCCCAAATTCACTGCATTTTCTCTCTCATCCCCTATAAACTCGATGCAATTTCGCAGGTTCTACACCTCTCTAGCGAATTCTAACC
GCAACCCATTTCTCCTATATCGAAATCTCACAAACCCTTTTGCTGTTTTCGACCCTAACCCACAGTTTCTCTCTACACAAAGAATCTTGAAAAACTGGGT
TCAAAGGCCAATTCGTGTGTCGAAACGTTTTGTCTCATCATTTCCTGCTATGGCAGAAGGAAGAAGACCCACTCATGTGCCTATACCACCCCCAGAAACT
GCTGATAAGGCGGAATTGTATCGAGCACTTGAGGCTGCGGTGGGGTCGCAGTTTAGTTCAGAGCCATTGGCACCGGAGCCTCATCCTTTGATTATTGTGG
TTAGTGGTCCAAGTGGGGTTGGTAAAGATGCTGTGATTAAAAGGCTTAGAGAAGTTAGGGAGAATATTCATTTTGTTGTTACTGCAACGACAAGGGGGAA
AAGGCCGGGTGAGGTTGATGGAAAAAATTACTTTTTTACGAGTAAAGAAAAGTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969248
Expected error %
0.285769
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g06200.1 Score 120 E Value 6e-28 Identity 16.80% Align. Length 350bp (53.35%) Frame 3
68416.m00713 guanylate kinase, putative similar to guanylate kinase (GMP kinase) [Bacillus halodurans] Swiss-Prot:Q9K9Y2; contains Pfam profile: PF00625 guanylate kinase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL38595.1| Score 120 E Value 3e-26 Identity 16.80% Align. Length 350bp (53.35%) Frame 3
AT3g06200/F28L1_14 [Arabidopsis thaliana] gb|AAK55680.1| AT3g06200/F28L1_14 [Arabidopsis thaliana] ref|NP_566276.1| guanylate kinase, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF30313.1| Score 118 E Value 1e-25 Identity 19.60% Align. Length 284bp (43.29%) Frame 3
putative guanylate kinase [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0038I12
Clone
Clone name
hba-38i12
LE_HBa0038I12
C11HBa0038I12
P038I12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found