Clone Read LE_HBa0038L19_T7_93109

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0038L19_T7_93109
Primer
T7
ID from Seq. Facility
LE_HBa_038_L19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
650 trimmed for vector and quality, 780 raw
Genbank Accession
Sequence
>LE_HBa0038L19_T7_93109 (raw untrimmed)
CCCTGGTCCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTGTTCTTCAATGGAGGATAAACGTTGAGAGAGAAAGTAGAGAGAAGTGAG
TGAAATTTGGGTTTCCATTGAGTTTGTGTTTTGGAGTGGGAAATTAATGAAAATTGACCTAAAGTCAATATATAGTCCACCCCCAAAATACCCAAACTAC
CCTTCATTAAGTTGGACTTCCAAAACTGAAGTCCAACTTAACTTCATTGTGAGACCACGTCCACCTTCACGCCCCACTTCTTGGACCGTGAAGAGCTTGA
TGGGTCATGGTGGTGGTCGTGAAGATGAGAAAGTAGCTCCTCCAAAGAATCCTTATCTATTTCTCCCACCAAGGCAAGACCACGGAGCACCTTTCCCCCT
TCCGTAAAGATGCACCATGACCCTTCAAATGGCTCGTGGTGCTTAGACAGTATCTTACCTTCACTCACCCTCACACCCTTTTTTACCTAAGGACTTTTAA
CGGGATCCCCTTGCCCTCCATCAAGTTCACCACGAGTCTTGGAGTGGCTCATGGTGTCTTAGGCAGTAGCTAGGCTTCCCTAGGAACTCCCCCCATGGAT
AAGGATTCTTCACGAGATCCCCACCTTGGCCATGGTCAATACCATGAGCCATGATCATTGCTTGTGAAGAGTGAGGCAATGATATACCATGTTTTCACCG
TATTTTTATACTTTTTTCCTTAAGTTTAGAATGGGGCCCAAAAGCCCTTTTTGGTATAAATTTTTTATTCTAGGTTTTCC
>LE_HBa0038L19_T7_93109 (trimmed for quality and cloning vector)
AGCTTCTTGTTCTTCAATGGAGGATAAACGTTGAGAGAGAAAGTAGAGAGAAGTGAGTGAAATTTGGGTTTCCATTGAGTTTGTGTTTTGGAGTGGGAAA
TTAATGAAAATTGACCTAAAGTCAATATATAGTCCACCCCCAAAATACCCAAACTACCCTTCATTAAGTTGGACTTCCAAAACTGAAGTCCAACTTAACT
TCATTGTGAGACCACGTCCACCTTCACGCCCCACTTCTTGGACCGTGAAGAGCTTGATGGGTCATGGTGGTGGTCGTGAAGATGAGAAAGTAGCTCCTCC
AAAGAATCCTTATCTATTTCTCCCACCAAGGCAAGACCACGGAGCACCTTTCCCCCTTCCGTAAAGATGCACCATGACCCTTCAAATGGCTCGTGGTGCT
TAGACAGTATCTTACCTTCACTCACCCTCACACCCTTTTTTACCTAAGGACTTTTAACGGGATCCCCTTGCCCTCCATCAAGTTCACCACGAGTCTTGGA
GTGGCTCATGGTGTCTTAGGCAGTAGCTAGGCTTCCCTAGGAACTCCCCCCATGGATAAGGATTCTTCACGAGATCCCCACCTTGGCCATGGTCAATACC
ATGAGCCATGATCATTGCTTGTGAAGAGTGAGGCAATGATATACCATGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969758
Expected error %
0.811839
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0038L19
Clone
Clone name
hba-38l19
LE_HBa0038L19
C02HBa0038L19
P038L19
Clone type
BAC
Contamination
none
Estimated length
115,429
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found