Clone Read LE_HBa0043B24_SP6_93406

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0043B24_SP6_93406
Primer
SP6
ID from Seq. Facility
LE_HBa_043_B24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
531 trimmed for vector and quality, 735 raw
Sequence
>LE_HBa0043B24_SP6_93406 (raw untrimmed)
GGGGTTTTGCTACGGAGGGAAACACCCGTGATCACCAGCTAAGGCCCCTAAATGACCGCTCAGTGATAAAGGACCCTTTGGTGCAGAGACAGCCAGGAGG
TTTTCCTAGAAGCAGCCCCTCTTGAAAGAGTGCATAATATCTCACTGATTGAGCGCTCTTACACCGAAGATGAACGGGGCTAAGAGGTCTTCCGAAGTTG
TGGGATGTAAAAATACACCAGTAAGGGAGCGTTCCGCCTTAGAGAGAAGACTCCGCGCGAGCGGTGGTGGACGAAGCGAAAGCGAGAATGTCAGCTTGAG
TAACACACACATTGGTGAGAATCCAATGCCCCGAAAACCTAAGGGTTCCTCCGCAAGGTTCGTCCATGGAGGATGAGTTAGGGCCTAAGATCAGGCTGAA
AGGCATAGTCAATGGACAACTTGTGAATATTCCTGTACTACCCCTTGTTAGTCCCGAGGGACGGAGGAGGCTAGGTTAGCCGAAAGATGGTTATCGGTTC
AAGAACGTAAGGTGTCCCAGCTTTTTCAGGGTAAGAAGGGGTAGATAAAATGCCTCGAGCCAATGTTCGAATACCAGGCGCTACGACGCTGAAGTAACCC
ATGCCATACTCCCAGGAAAATCCTCAAACGACCTTAAGCAACGGGGTACCCTATACCCGAAACTGACATAGGTGTGTTGGGTAGAGAATACTTGGGGGCG
CTAGAACAACTCTCTCTTAGGGAATTCCGGTAAAT
>LE_HBa0043B24_SP6_93406 (trimmed for quality and cloning vector)
GATCACCAGCTAAGGCCCCTAAATGACCGCTCAGTGATAAAGGACCCTTTGGTGCAGAGACAGCCAGGAGGTTTTCCTAGAAGCAGCCCCTCTTGAAAGA
GTGCATAATATCTCACTGATTGAGCGCTCTTACACCGAAGATGAACGGGGCTAAGAGGTCTTCCGAAGTTGTGGGATGTAAAAATACACCAGTAAGGGAG
CGTTCCGCCTTAGAGAGAAGACTCCGCGCGAGCGGTGGTGGACGAAGCGAAAGCGAGAATGTCAGCTTGAGTAACACACACATTGGTGAGAATCCAATGC
CCCGAAAACCTAAGGGTTCCTCCGCAAGGTTCGTCCATGGAGGATGAGTTAGGGCCTAAGATCAGGCTGAAAGGCATAGTCAATGGACAACTTGTGAATA
TTCCTGTACTACCCCTTGTTAGTCCCGAGGGACGGAGGAGGCTAGGTTAGCCGAAAGATGGTTATCGGTTCAAGAACGTAAGGTGTCCCAGCTTTTTCAG
GGTAAGAAGGGGTAGATAAAATGCCTCGAGC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976618
Expected error %
0.503245
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|ZP_00327143.1| Score 90 E Value 3e-17 Identity 21.30% Align. Length 224bp (42.18%) Frame 1
hypothetical protein Tery02002584 [Trichodesmium erythraeum IMS101]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO74140.1| Score 90 E Value 3e-17 Identity 21.60% Align. Length 203bp (38.23%) Frame 1
ORF64c [Pinus koraiensis] ref|NP_817269.1| ORF64c [Pinus koraiensis]
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 101 E Value 5e-23 Identity 87.30% Align. Length 117bp (22.03%) Frame 2
No sequence description found.
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 735 E Value 0 Identity 92.50% Align. Length 530bp (99.81%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0043B24
Clone
Clone name
hba-43b24
LE_HBa0043B24
P043B24
Clone type
BAC
Contamination
none
Estimated length
125,811
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found