Clone Read LE_HBa0043C20_T7_93447

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0043C20_T7_93447
Primer
T7
ID from Seq. Facility
LE_HBa_043_C20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 819 raw
Genbank Accession
Sequence
>LE_HBa0043C20_T7_93447 (raw untrimmed)
CCGGGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATTTTCTTCAGAGTGTAGAAAACCATCCTCAAATAATGCTCGTGATCCTT
CCTACTACGGGAGTATACCAATATATCCTAGATGAAAATAATAACAAAGGAAACTCAATATGATAGAAACACCAATAAAAGTGTACTTGATCCAACAAAA
TTTACTTACTCAACAAATCTTGTTACCGTTCTTTCAAATTCACTAAAGTAGTCCAATAAGAAGTAATAGAAATAGGCCAAGTGTCTAACTATAAGTCAAT
ACTAATTTTTATATCAAGCTCACATGAAATGCCCTAAAAAAAAACTCTTGCACCATTGGAATGAGCTCTAAGGAGATATATCATCACTAGTATCACAACT
TAAGACGAATAGGTGAAGCAACCCTTGTTCCTCACATTGAATCTTTAGAGTCAATGATACCTTTCTTAAATGGGTAATGAGACTATCCCGCCACTTAAAT
TTTGAAATATCAGACATATTTGAAGTTAGTGGCTTACACTTATAGTCATAAATTTCATGACAATGAGAAATTCAATCCATATCCAAATGATGTTTAAATC
TTCCGTATATAAAATAAACCTATGATTTTCCACGTGTCATATACTATTAAGTCAATATAAGATCCGATGTAATCCGATCTACCACTAAAAAACATCTACC
GGTGAAGGAATATGTATAGATATAAAAAGAAGGGTCCCAAAGCATATCCAGATCCCAAATTAAGGGACATACCTTAGTTAAATTTGAATTTGATTCAGCT
TATCAAAAAAAATTTTTTT
>LE_HBa0043C20_T7_93447 (trimmed for quality and cloning vector)
AGCTTAATTTTCTTCAGAGTGTAGAAAACCATCCTCAAATAATGCTCGTGATCCTTCCTACTACGGGAGTATACCAATATATCCTAGATGAAAATAATAA
CAAAGGAAACTCAATATGATAGAAACACCAATAAAAGTGTACTTGATCCAACAAAATTTACTTACTCAACAAATCTTGTTACCGTTCTTTCAAATTCACT
AAAGTAGTCCAATAAGAAGTAATAGAAATAGGCCAAGTGTCTAACTATAAGTCAATACTAATTTTTATATCAAGCTCACATGAAATGCCCTAAAAAAAAA
CTCTTGCACCATTGGAATGAGCTCTAAGGAGATATATCATCACTAGTATCACAACTTAAGACGAATAGGTGAAGCAACCCTTGTTCCTCACATTGAATCT
TTAGAGTCAATGATACCTTTCTTAAATGGGTAATGAGACTATCCCGCCACTTAAATTTTGAAATATCAGACATATTTGAAGTTAGTGGCTTACACTTATA
GTCATAAATTTCATGACAATGAGAAATTCAATCCATATCCAAATGATGTTTAAATCTTCCGTATATAAAATAAACCTATGATTTTCCACGTGTCATATAC
TATTAAGTCAATATAAGATCCGATGTAATCCGATCTACCACTAAAAAACATCTACCGGTGAAGGAATATGTATAGATATAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.933143
Expected error %
0.998465
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0043C20
Clone
Clone name
hba-43c20
LE_HBa0043C20
P043C20
Clone type
BAC
Contamination
none
Estimated length
83,894
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found