Clone Read LE_HBa0046C15_SP6_94204

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0046C15_SP6_94204
Primer
SP6
ID from Seq. Facility
LE_HBa_046_C15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
523 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0046C15_SP6_94204 (raw untrimmed)
ATTTTGCCGGCGCAAGTAGGCAAAAAGAATACGTGGGATCGAAAGGTTAGAGACTTAGAGTTCATGGAGGGTGAACAAGTCTTGCTGAAGGTTTCGCCAA
TGAAAGGGGTGATGCGGTTTGGAAAAAGGGGTAAACTAAGCCCAAGGTATATTGGTCCCTTCGAGGTTCTGAAGCGCATAGGGTAGGTGGCTTATGAGTT
AGCCTTGCCTCCAGGGCTGTCCGGAGTGCATCCGGTATTCCATGTGTCTATGTTGAAAAGATACCATGGGGATGGAAACTAAATTATCCGTTGGGATTCA
GTTTTGCTTGATGAGAATTTGTCTTATGAGGAGGAACCTTTTGCCATTCTAGATAGAGAAATTCGCAAGTTGAGATCAAGGGAGATTGCATCCATCAAAG
TTCAATGGAAGAATCGACCCGTTGAAGAAGCCACTTGGGAGAAGGAGGCAGATATGCGAGAAAGATACCCACATCTGTTTACAGATTCAGGTACTCCTTT
TCGCCCTTGTTTTCCTTCTTGTGATCGTTCGGGGACTAATGATGGGTAAATTGGTATCTATTGTAACGACCTGTTTAATCGTTTTTGAGCAGTAAATTTT
ATTTCTGAGAAAAAACAGGCTGATGCGACGGAACTCCACATCGGGCCGTTTTGGGCCACTGACGGACCTTCAGTTGCCCGTTCGGAACCAGCCCAATGGT
TTGCGCTTACAAAGATTTAATACACACGTAATAACTGCATGCTCTAAATTGTCTTCCCTCTATCCCTTTTATCCTTAATCGTCAGTGGTAGAACGCTCCA
CCATGAGTTGTTCAGCTGTTCCTTCCAATCTCTGCTTTCCNAACTTA
>LE_HBa0046C15_SP6_94204 (trimmed for quality and cloning vector)
ATCGAAAGGTTAGAGACTTAGAGTTCATGGAGGGTGAACAAGTCTTGCTGAAGGTTTCGCCAATGAAAGGGGTGATGCGGTTTGGAAAAAGGGGTAAACT
AAGCCCAAGGTATATTGGTCCCTTCGAGGTTCTGAAGCGCATAGGGTAGGTGGCTTATGAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGTGCATCCGGTA
TTCCATGTGTCTATGTTGAAAAGATACCATGGGGATGGAAACTAAATTATCCGTTGGGATTCAGTTTTGCTTGATGAGAATTTGTCTTATGAGGAGGAAC
CTTTTGCCATTCTAGATAGAGAAATTCGCAAGTTGAGATCAAGGGAGATTGCATCCATCAAAGTTCAATGGAAGAATCGACCCGTTGAAGAAGCCACTTG
GGAGAAGGAGGCAGATATGCGAGAAAGATACCCACATCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTTGTTTTCCTTCTTGTGATCGTTCGGGGACT
AATGATGGGTAAATTGGTATCTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962624
Expected error %
0.0922347
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 200 E Value 1e-50 Identity 21.00% Align. Length 446bp (85.28%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 194 E Value 1e-48 Identity 20.60% Align. Length 446bp (85.28%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0046C15
Clone
Clone name
hba-46c15
LE_HBa0046C15
C02HBa0046C15
P046C15
Clone type
BAC
Contamination
none
Estimated length
72,345
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found