Clone Read LE_HBa0046C15_T7_94205

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0046C15_T7_94205
Primer
T7
ID from Seq. Facility
LE_HBa_046_C15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
765 trimmed for vector and quality, 960 raw
Genbank Accession
Sequence
>LE_HBa0046C15_T7_94205 (raw untrimmed)
ACTAAACTGGGTCCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAATAATGACTCTGTTAAGAACTTTTGGATTAATGGTCATTGGAATG
AGAGGAAACTAAGACAGCTGGTACATCCATTACTAATTCCTATGATCCTGAACACTAGAATTCATTATCAAAATGATCAGCAGCATATAGTAATCTGGAA
ACCTACTGATTCTGGTAACTTCACTTGTGCATCATCTTGGGATATTTGCAGATATAAAGGGAATGTGGATGTGGTTAATAAGTTTATTTGTCACAAAAAT
ATGCCTTTCAAAATATCATTTTTACTATGGAGAGCCTTAAGATTAAAATTTCCTACTAATGAAATATTGGCAAATTTTGGAGTAGAACCTGCTAAATGTT
GTTGTTGTAGGAACCAAGGATGGGATGATGTAGATCATATATTTATTCAAGGTCCTTTTGCCACTCATATTTGGAAGTAATTTTCTAGTTCTGTGGGCAT
CAATATTCAACAATGCTCCTTGAGAAATAGGATTATTCAATGGTATAACAACAAAGGCAAAAATGATGCACATAGAGCTGTTATAATAATTCTTCCTATA
GTTATTTGTTGGAATCTGTGGAAGAATAGACGTGTTGCTAAATATGGGGGAAAGACTTCAAGTAGCTACGAAGCTAAATATTTCATTCAAAAGGAAATTC
TGAAGTTTCTGTATTCTATTTTTCCTAACTTACAATGGTCAAGGAAATGGACAGAACATGTAGAACTTTCTAGAAAAATATCACATATGATAAAGGTCAA
TATAATTTTTGGAAACCACCCCCAATGCCTAATATATTTGAACCCCGCTGAAAGGCATTGAGTATCCGGGAAGGATAGGAGGGGGGGAAATTTTAAGAAT
GCGCCTGGCTGCCCCCACTCAGTCATTTATTTTTACCTTCGGGGAAGGCTCAGCGTGCTT
>LE_HBa0046C15_T7_94205 (trimmed for quality and cloning vector)
AGCTTTAATAATGACTCTGTTAAGAACTTTTGGATTAATGGTCATTGGAATGAGAGGAAACTAAGACAGCTGGTACATCCATTACTAATTCCTATGATCC
TGAACACTAGAATTCATTATCAAAATGATCAGCAGCATATAGTAATCTGGAAACCTACTGATTCTGGTAACTTCACTTGTGCATCATCTTGGGATATTTG
CAGATATAAAGGGAATGTGGATGTGGTTAATAAGTTTATTTGTCACAAAAATATGCCTTTCAAAATATCATTTTTACTATGGAGAGCCTTAAGATTAAAA
TTTCCTACTAATGAAATATTGGCAAATTTTGGAGTAGAACCTGCTAAATGTTGTTGTTGTAGGAACCAAGGATGGGATGATGTAGATCATATATTTATTC
AAGGTCCTTTTGCCACTCATATTTGGAAGTAATTTTCTAGTTCTGTGGGCATCAATATTCAACAATGCTCCTTGAGAAATAGGATTATTCAATGGTATAA
CAACAAAGGCAAAAATGATGCACATAGAGCTGTTATAATAATTCTTCCTATAGTTATTTGTTGGAATCTGTGGAAGAATAGACGTGTTGCTAAATATGGG
GGAAAGACTTCAAGTAGCTACGAAGCTAAATATTTCATTCAAAAGGAAATTCTGAAGTTTCTGTATTCTATTTTTCCTAACTTACAATGGTCAAGGAAAT
GGACAGAACATGTAGAACTTTCTAGAAAAATATCACATATGATAAAGGTCAATATAATTTTTGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.939696
Expected error %
0.571298
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38702.1| Score 132 E Value 1e-29 Identity 9.80% Align. Length 704bp (92.03%) Frame 2
putative RNase H domain containing protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89759.1| Score 116 E Value 7e-25 Identity 9.80% Align. Length 581bp (75.95%) Frame 2
hypothetical protein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0046C15
Clone
Clone name
hba-46c15
LE_HBa0046C15
C02HBa0046C15
P046C15
Clone type
BAC
Contamination
none
Estimated length
72,345
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found