Clone Read LE_HBa0046F10_T7_94339

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0046F10_T7_94339
Primer
T7
ID from Seq. Facility
LE_HBa_046_F10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
603 trimmed for vector and quality, 991 raw
Genbank Accession
Sequence
>LE_HBa0046F10_T7_94339 (raw untrimmed)
GGTATGGCGGGTCCGGGGGATCTTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTCTCACACTTTTCAATCCCTCGCCCGTTCCAAATGTTCAAAGACT
TCGATTTGGCTCCTAAGGGCCTGCCCAGATAGATGGTAGGCAAAGAACCTACTTCCCCTCCCAAAATCCAAGGCAGTTCCTCCATATTAGAAACATTATT
AATAGGATACAACTGACTCTTTCTCCAGTTGATATAACCAATAGTTGTCCCACATTAGCATCACAAAATATTAAGGTGTCATCTGCATACTGTAAATGAG
GATTTCTATGTTGCCATTTGATATTGAGGTTTGAGTTGTGACTACCTCAAAACCCCTGAGGAATTCGTTTGATATGTTATTTAGGCCCTCCATAACAATG
ATAAAAAGGAAAGGAGATAGGGGATCTCCCTGCCTCAGTCCCCTTTGAGCGGTGCACTATTTATAAGGACTGAGAATCTGACACTAGAGATGCAATACTT
GATCCACTGAATCCACCTCCTTCCAAACCCATACATGCAAACATCTTCAGTAAAAACTTCCAGTTCACATGGTTATATGCCTTTTCTATGTCCAGTTTGC
ACAAGATTCCTGCCTTTCATTGGGTAATTCTTGTATCTACTAACTTCGTTAGTAATTAGAATAGCATCCATTATTTCTCGATTTTTTATGAATGTCATCT
GTTGAGCAACAACTTGCTTTGCTACCCTTTTCTTCACGCTTTCATTCGAAACTATGGATAACAACTTAATAAACTTTACATATAATTCACGTGCTTAAAA
TCCTCAGTTCTTGGTGACATTTTCAGATGGGGTTAAGCAATGTAGGGGGGTTGAGTGCTTTCCGAATAATTCTCCAGAATGGAGTTCTTCCATGGTAGCG
CGGATTGCCTTTTTCCTATTTCCTTCTATTAAGAAACTGAACCTATTGGTATCTTCTGGGGCTTGAGGTTTTTCATATTATGTGTGTATTT
>LE_HBa0046F10_T7_94339 (trimmed for quality and cloning vector)
AGCTTTTTCTCACACTTTTCAATCCCTCGCCCGTTCCAAATGTTCAAAGACTTCGATTTGGCTCCTAAGGGCCTGCCCAGATAGATGGTAGGCAAAGAAC
CTACTTCCCCTCCCAAAATCCAAGGCAGTTCCTCCATATTAGAAACATTATTAATAGGATACAACTGACTCTTTCTCCAGTTGATATAACCAATAGTTGT
CCCACATTAGCATCACAAAATATTAAGGTGTCATCTGCATACTGTAAATGAGGATTTCTATGTTGCCATTTGATATTGAGGTTTGAGTTGTGACTACCTC
AAAACCCCTGAGGAATTCGTTTGATATGTTATTTAGGCCCTCCATAACAATGATAAAAAGGAAAGGAGATAGGGGATCTCCCTGCCTCAGTCCCCTTTGA
GCGGTGCACTATTTATAAGGACTGAGAATCTGACACTAGAGATGCAATACTTGATCCACTGAATCCACCTCCTTCCAAACCCATACATGCAAACATCTTC
AGTAAAAACTTCCAGTTCACATGGTTATATGCCTTTTCTATGTCCAGTTTGCACAAGATTCCTGCCTTTCATTGGGTAATTCTTGTATCTACTAACTTCG
TTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961641
Expected error %
1.02556
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL78659.1| Score 46 E Value 2e-17 Identity 52.60% Align. Length 261bp (43.28%) Frame 2
reverse transcriptase [Fagus sylvatica]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD21778.1| Score 41 E Value 3e-11 Identity 42.30% Align. Length 291bp (48.26%) Frame 2
putative non-LTR retroelement reverse transcriptase [Arabidopsis thaliana] pir||G84429 hypothetical protein At2g01840 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0046F10
Clone
Clone name
hba-46f10
LE_HBa0046F10
C12HBa0046F10
P046F10
Clone type
BAC
Contamination
none
Estimated length
115,391
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found