Clone Read LE_HBa0047M18_T7_9443

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0047M18_T7_9443
Primer
T7
ID from Seq. Facility
LE_HBa_047_M18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
566 trimmed for vector and quality, 918 raw
Genbank Accession
Sequence
>LE_HBa0047M18_T7_9443 (raw untrimmed)
CAACTCGGTACCGGGGGTATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTGGAAATAAGAGATTTGACACTTTGTGACCAAAAAGTCAAAATTGGC
TGGTAAGAGAGAGAAGGAGAGCTGACAAGGTATAGGACGTCATCCCATTTTAGCAACTTTCACCTGCTTCTCATCTGGGTACTTCCGGCACTGCTTGATT
TATTGATTTGGTGATTCTAAACTTCAGTTGATTTCTCACTGATTCACTGAAAAGCTGAGGGACACAGAAGGGCTAAAGAAATTGAAGGGGGAAAAAACCC
CAACAGAAAATTACAAGATTTGATGATTCTATTGTCTTATTTTAGCTTTCTGGCAAAGCTTGAGCCTTTTGCTATAGACCCTTTTCGTTTCTTGAACTGT
AAGTGGCTTAGCTTTCTTTAGTCTTCAGTTATTATGTAACTTGCTACTGTATTGCTTACTGCTTTTTTTTTTTTTTTTTTTAAGTTGGGTGTGGTTGTTT
TGGGCTGGAGGGTTATAAAGTTTGGATTTTGAGGACTTTGTGAGTAAAGGGTTTACTTTTTTTGATTCTGTTGAGGATGGGGAGGGGTGAGGTGTGGATT
AAGGAGGAATTTTTGTTTCGAATTAAAGTAAATTTAATTAAAGATATTTAAGAATCATAAAATTTCAGTTATTTAGATTTAAAATGCTTTAGGATTAGAA
AATTAGATGAAAATTATTAAGATTAAACCTGTAGAGGTCCTACTCTCGAAGCGACACTTTGACAACACATTCCATATAAGTGATCATAATACTTCTTCTA
CAAAAACCTAATAAAGAAAAAGACCTTCGGAAGGGGCCCGAACGAAGAGATTATGACTGCAGACTTTTTAACCAAAAAAAATTAAAAAAAACTCCATAAC
AAAAATGGAAAAAAACAC
>LE_HBa0047M18_T7_9443 (trimmed for quality and cloning vector)
AGCTTCTTGGAAATAAGAGATTTGACACTTTGTGACCAAAAAGTCAAAATTGGCTGGTAAGAGAGAGAAGGAGAGCTGACAAGGTATAGGACGTCATCCC
ATTTTAGCAACTTTCACCTGCTTCTCATCTGGGTACTTCCGGCACTGCTTGATTTATTGATTTGGTGATTCTAAACTTCAGTTGATTTCTCACTGATTCA
CTGAAAAGCTGAGGGACACAGAAGGGCTAAAGAAATTGAAGGGGGAAAAAACCCCAACAGAAAATTACAAGATTTGATGATTCTATTGTCTTATTTTAGC
TTTCTGGCAAAGCTTGAGCCTTTTGCTATAGACCCTTTTCGTTTCTTGAACTGTAAGTGGCTTAGCTTTCTTTAGTCTTCAGTTATTATGTAACTTGCTA
CTGTATTGCTTACTGCTTTTTTTTTTTTTTTTTTTAAGTTGGGTGTGGTTGTTTTGGGCTGGAGGGTTATAAAGTTTGGATTTTGAGGACTTTGTGAGTA
AAGGGTTTACTTTTTTTGATTCTGTTGAGGATGGGGAGGGGTGAGGTGTGGATTAAGGAGGAATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.927651
Expected error %
0.473859
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0047M18
Clone
Clone name
hba-47m18
LE_HBa0047M18
P047M18
Clone type
BAC
Contamination
none
Estimated length
96,080
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found