Clone Read LE_HBa0046M08_T7_94671

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0046M08_T7_94671
Primer
T7
ID from Seq. Facility
LE_HBa_046_M08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
826 trimmed for vector and quality, 985 raw
Genbank Accession
Sequence
>LE_HBa0046M08_T7_94671 (raw untrimmed)
TTAAACCCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACAAGGAACTCGCTACTCTCCCTTTTTGAGTTGGACAGGGTACTTT
ACTTGCTTAAGATTGCTCCTTATAATGGTGAGGCTGCTAAAAAGAGGGAGCTGAAAGTACAAGAACCAAAGACCAATATGACCAAAACTGTTGCAACTGC
TGCCCGTCAGCAGCCTCCACCCGAGCAGAACAAAAAAGATAGAGCAGAACCTAAGGTTTTAATGGAGAAACAGGATACTATTGATGCGAACTCTTCATTC
AGTCAAGAAACAAAGAAGGAGATTGTGGCTGATGCAGCTGGTGGTAAAAATGTTGTGTACATTGCTAGTAAGCCCCAATGGCTTGGTGCTGTAGATGAAA
AGAAAAAACAAGAGAAAGTTATTGAACGACAGACAGAACTGCAAGACAATGATCAATTTGTTGACTACAAAGACAGGAATAAAGTTTTGGTAAAACCAGA
TGCTACACAGTTGACTGCTGACTCTGGAATTGAAAGTGCAGCTCCTGGACTAATAATAAGGAAGCGCAAGCAAGTTGAGAAGTCTGATGTTACTGAAGTC
AAACATTCTCAAGAATCCACTGGAGCTGATTTACAAGCAGAAGATGCGGTAGCTCTGCTGTTGAAACATTCTCAAAGATACCATAGTACTGATGATGAAG
TGGAATTCCAGCGGAGGTGATGTATCACATGAAAGTCAAAACGAAGAAAGAAAAGAAAAAAAAGCAAAAGAAGGTTCTTGGTCCCGACAGACCATCATTT
TCTTGAAGATGGAGAAGGATTACAATTCTTGGGTTCCTCCTGAAGGTATCCACTTATTTGGTTCATGGCCACGCTTAGTGCCTACTAAGTGAGGTTCAAG
TTTTTTTGAAAAATTAGCTGGCTTTGTGAATTTTTACAGGGCAATCAGGGGACGGACGCTCCTCATGATTGATGCTTTGGTACTG
>LE_HBa0046M08_T7_94671 (trimmed for quality and cloning vector)
AGCTTCACAAGGAACTCGCTACTCTCCCTTTTTGAGTTGGACAGGGTACTTTACTTGCTTAAGATTGCTCCTTATAATGGTGAGGCTGCTAAAAAGAGGG
AGCTGAAAGTACAAGAACCAAAGACCAATATGACCAAAACTGTTGCAACTGCTGCCCGTCAGCAGCCTCCACCCGAGCAGAACAAAAAAGATAGAGCAGA
ACCTAAGGTTTTAATGGAGAAACAGGATACTATTGATGCGAACTCTTCATTCAGTCAAGAAACAAAGAAGGAGATTGTGGCTGATGCAGCTGGTGGTAAA
AATGTTGTGTACATTGCTAGTAAGCCCCAATGGCTTGGTGCTGTAGATGAAAAGAAAAAACAAGAGAAAGTTATTGAACGACAGACAGAACTGCAAGACA
ATGATCAATTTGTTGACTACAAAGACAGGAATAAAGTTTTGGTAAAACCAGATGCTACACAGTTGACTGCTGACTCTGGAATTGAAAGTGCAGCTCCTGG
ACTAATAATAAGGAAGCGCAAGCAAGTTGAGAAGTCTGATGTTACTGAAGTCAAACATTCTCAAGAATCCACTGGAGCTGATTTACAAGCAGAAGATGCG
GTAGCTCTGCTGTTGAAACATTCTCAAAGATACCATAGTACTGATGATGAAGTGGAATTCCAGCGGAGGTGATGTATCACATGAAAGTCAAAACGAAGAA
AGAAAAGAAAAAAAAGCAAAAGAAGGTTCTTGGTCCCGACAGACCATCATTTTCTTGAAGATGGAGAAGGATTACAATTCTTGGGTTCCTCCTGAAGGTA
TCCACTTATTTGGTTCATGGCCACGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959155
Expected error %
1.6533
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g38840.1 Score 124 E Value 5e-29 Identity 13.40% Align. Length 635bp (76.88%) Frame 2
68418.m04698 forkhead-associated domain-containing protein / FHA domain-containing protein related to adaptor protein kanadaptin [Homo sapiens] gi|13562130|gb|AAK29177
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_198700.2| Score 124 E Value 2e-27 Identity 13.40% Align. Length 635bp (76.88%) Frame 2
forkhead-associated domain-containing protein / FHA domain-containing protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB08640.1| Score 124 E Value 2e-27 Identity 13.40% Align. Length 635bp (76.88%) Frame 2
unnamed protein product [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0046M08
Clone
Clone name
hba-46m8
LE_HBa0046M08
C02HBa0046M08
P046M08
Clone type
BAC
Contamination
none
Estimated length
104,675
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found