Clone Read LE_HBa0091I01_T7_95233

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091I01_T7_95233
Primer
T7
ID from Seq. Facility
LE_HBa_091_I01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
763 trimmed for vector and quality, 855 raw
Sequence
>LE_HBa0091I01_T7_95233 (raw untrimmed)
GCCTACCTGGTACCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACTATGTGAAAGTGAATACCTTTAGGGGTTATCAATTTACATAGCG
ACTTCCTACTTGCTTTTAGGGGTTTTGAAGGTAAAAGCATAATAAATACCCTCGAAATTGTGACTCCATGTTAACCAATGCATTCGTGAGTCTAGACACA
ACATCTGCAACACTTTCTCCACCTTCAGGCTGCATGAATGGATCCTTCTCATCTAGAGCCCATATATCAGGATACTGAAATGAGAAATAATTAATCAATT
CAAGAGCCACAAGCCAAGTTGAAGGTGTTCAAGATTGTGTCACATCCACTTGATTTTGAAATGCAGAAGACAAACAACTTACTTTATCATGAGACTTAAG
TTCATAAGAAGGACCAAAGAAGCGCTCCCGAAGATCATCTAGAACCTATTATAACAAAATTATCTTAACTCAGAGCTTATCAACAGAATCTCGTCGGCTT
AAAGCCAAAATCATAACACACCAGTCAATCAATTGTTCTAGCTCAGAAACATCTCATCAAGACAGAAAAGACAGGAATCAACATAATACTAAAAAACCTT
TCTAAGCTTATTGGTGATTGGCTTCAAGTCCATCAGGCAAAGATTGATATAAAACATGAAAAGTTAACAACAGCTGAATCAAATACATCTTCAGAAGAAA
AAGTACATAGCAGTTCAGCTTAACCATATAAATTTAGAGATACTCCATTTAAGGAAGCAATGATATAGGGTGAAAAAAGAGAAATAGCCCAAACAGTTCA
TTTAATGACCATACTTATACCAATAGAGAAAAGCTAGATTTCAACCTATGAAGTA
>LE_HBa0091I01_T7_95233 (trimmed for quality and cloning vector)
AGCTTCACTATGTGAAAGTGAATACCTTTAGGGGTTATCAATTTACATAGCGACTTCCTACTTGCTTTTAGGGGTTTTGAAGGTAAAAGCATAATAAATA
CCCTCGAAATTGTGACTCCATGTTAACCAATGCATTCGTGAGTCTAGACACAACATCTGCAACACTTTCTCCACCTTCAGGCTGCATGAATGGATCCTTC
TCATCTAGAGCCCATATATCAGGATACTGAAATGAGAAATAATTAATCAATTCAAGAGCCACAAGCCAAGTTGAAGGTGTTCAAGATTGTGTCACATCCA
CTTGATTTTGAAATGCAGAAGACAAACAACTTACTTTATCATGAGACTTAAGTTCATAAGAAGGACCAAAGAAGCGCTCCCGAAGATCATCTAGAACCTA
TTATAACAAAATTATCTTAACTCAGAGCTTATCAACAGAATCTCGTCGGCTTAAAGCCAAAATCATAACACACCAGTCAATCAATTGTTCTAGCTCAGAA
ACATCTCATCAAGACAGAAAAGACAGGAATCAACATAATACTAAAAAACCTTTCTAAGCTTATTGGTGATTGGCTTCAAGTCCATCAGGCAAAGATTGAT
ATAAAACATGAAAAGTTAACAACAGCTGAATCAAATACATCTTCAGAAGAAAAAGTACATAGCAGTTCAGCTTAACCATATAAATTTAGAGATACTCCAT
TTAAGGAAGCAATGATATAGGGTGAAAAAAGAGAAATAGCCCAAACAGTTCATTTAATGACCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.949035
Expected error %
0.492818
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38370.1 Score 77 E Value 1e-14 Identity 14.70% Align. Length 278bp (36.44%) Frame 3
68417.m05425 phosphoglycerate/bisphosphoglycerate mutase family protein contains Pfam profile PF00300: phosphoglycerate mutase family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80502.1| Score 77 E Value 5e-13 Identity 14.70% Align. Length 278bp (36.44%) Frame 3
hypothetical protein [Arabidopsis thaliana] emb|CAB37493.1| hypothetical protein [Arabidopsis thaliana] pir||T05665 hypothetical protein F22I13.140 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM64469.1| Score 77 E Value 5e-13 Identity 14.70% Align. Length 278bp (36.44%) Frame 3
unknown [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091I01
Clone
Clone name
hba-91i1
LE_HBa0091I01
P091I01
Clone type
BAC
Contamination
none
Estimated length
108,065
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found