Clone Read LE_HBa0091I08_T7_95247

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0091I08_T7_95247
Primer
T7
ID from Seq. Facility
LE_HBa_091_I08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
188 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0091I08_T7_95247 (raw untrimmed)
TTAACCTCGGTTCCGAGGGGTGCTGCTAGAGTCTACCTCGCAGGCTGGCAAGCTTCGTTTGGACATCTTGCCATTGATTTTCCAGTTTTATTCTTAACAT
ATGCTCTAAGAACTGCTCGTCTCCATGATCTGTAACTAGTTCCATCAAACACTACAGGAAGCAAGGTAGAAGCAGCATTTTCAGATGGATGTAGGTAGAA
AGGGCTATTGAAGTCTGGTCGTTTTAAGGAGTTACTAGCATTCACGTTAGTTGAAATATCACCCATGGATCAATGGATCGATACCACCAACTAGGAAGTT
AGGCATCAGCACACGATCACCAAGCGGATATTAAAAGCATTCTCCCACTGCACTCTACCCCGTGCTAGTATCTCCCTGTATCAATGAATCAAGCAAATGT
TCCGCCCGTTATACATTAGCTTATTGTTTTTATTGAGGATCTATTGCGTATGACGAGTTCCAACATGTCTGAGAGATACTTCCACTGATACGACACCGGT
AGGAGAATCAGTCAGGTATAGGAAGAGGATATACATATCCTAGTTTACCTAGCATCGCAATGCTCCTCTCTGTACTCTCGAATCTGTTCTGTCTAGCATC
GACTCTAAGTCTCCGTTGCTGTCCCTGCGACTCTGTATGCTCCTCCGTTCTACCCCGTTGAGTCCTCCTCTGCCACTAGCTACACAGACTCCATCGACTA
TTGAATCTACACCCAACAACTCTTTTACTGTATTTTCTATACTGTTCTCATCTCCCTCTCTCACTCTCCCATTATTTCTCTTTCTTATTTCTTCTTCTCT
CGCGTAATGCCCCGATGCTCCCTTCCCTCTCTGCTTCTGCTTTATCTTTCTTTCCTCTGTCTCTTTCGTTT
>LE_HBa0091I08_T7_95247 (trimmed for quality and cloning vector)
TTTTATTCTTAACATATGCTCTAAGAACTGCTCGTCTCCATGATCTGTAACTAGTTCCATCAAACACTACAGGAAGCAAGGTAGAAGCAGCATTTTCAGA
TGGATGTAGGTAGAAAGGGCTATTGAAGTCTGGTCGTTTTAAGGAGTTACTAGCATTCACGTTAGTTGAAATATCACCCATGGATCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.965541
Expected error %
0.720697
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0091I08
Clone
Clone name
hba-91i8
LE_HBa0091I08
P091I08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found